\
| Variant ID: vg1125281578 (JBrowse) | Variation Type: SNP |
| Chromosome: chr11 | Position: 25281578 |
| Reference Allele: T | Alternative Allele: C |
| Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele: Not determined.
CAATGTGGTGAACGAGTCATGTTGGATGGATTATTTTTATTTCTCTTTTTTACTAATTCCTCCGTTTCACAATATAAGACTTTTTATTATTGTCCACATA[T/C]
ATATAGATGTTAATAATCTATACACATACATGTGTCTAGATTCATTAACATATAGATACATATGTTTTACATTGTGAAACGGAGGGAGTAATTTAACTGC
GCAGTTAAATTACTCCCTCCGTTTCACAATGTAAAACATATGTATCTATATGTTAATGAATCTAGACACATGTATGTGTATAGATTATTAACATCTATAT[A/G]
TATGTGGACAATAATAAAAAGTCTTATATTGTGAAACGGAGGAATTAGTAAAAAAGAGAAATAAAAATAATCCATCCAACATGACTCGTTCACCACATTG
| Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 53.00% | 15.60% | 0.72% | 30.68% | NA |
| All Indica | 2759 | 73.60% | 3.40% | 0.58% | 22.47% | NA |
| All Japonica | 1512 | 14.70% | 34.60% | 0.13% | 50.53% | NA |
| Aus | 269 | 68.80% | 20.80% | 4.83% | 5.58% | NA |
| Indica I | 595 | 45.90% | 2.20% | 0.84% | 51.09% | NA |
| Indica II | 465 | 68.00% | 3.70% | 0.22% | 28.17% | NA |
| Indica III | 913 | 88.90% | 3.90% | 0.77% | 6.35% | NA |
| Indica Intermediate | 786 | 80.00% | 3.40% | 0.38% | 16.16% | NA |
| Temperate Japonica | 767 | 2.70% | 54.00% | 0.26% | 43.02% | NA |
| Tropical Japonica | 504 | 31.50% | 9.90% | 0.00% | 58.53% | NA |
| Japonica Intermediate | 241 | 17.80% | 24.50% | 0.00% | 57.68% | NA |
| VI/Aromatic | 96 | 28.10% | 53.10% | 2.08% | 16.67% | NA |
| Intermediate | 90 | 46.70% | 13.30% | 1.11% | 38.89% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1125281578 | T -> DEL | N | N | silent_mutation | Average:44.761; most accessible tissue: Minghui63 panicle, score: 75.788 | N | N | N | N |
| vg1125281578 | T -> C | LOC_Os11g42030.1 | downstream_gene_variant ; 2843.0bp to feature; MODIFIER | silent_mutation | Average:44.761; most accessible tissue: Minghui63 panicle, score: 75.788 | N | N | N | N |
| vg1125281578 | T -> C | LOC_Os11g42030-LOC_Os11g42040 | intergenic_region ; MODIFIER | silent_mutation | Average:44.761; most accessible tissue: Minghui63 panicle, score: 75.788 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1125281578 | 3.25E-06 | NA | mr1306_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1125281578 | 4.52E-07 | NA | mr1733_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1125281578 | NA | 4.20E-07 | mr1733_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1125281578 | 1.80E-06 | NA | mr1735_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1125281578 | 8.71E-06 | NA | mr1757_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1125281578 | NA | 7.76E-06 | mr1763_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1125281578 | 7.76E-06 | NA | mr1771_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1125281578 | NA | 1.39E-07 | mr1837_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1125281578 | 3.48E-06 | NA | mr1866_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1125281578 | 7.85E-07 | NA | mr1905_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |