\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1125281578:

Variant ID: vg1125281578 (JBrowse)Variation Type: SNP
Chromosome: chr11Position: 25281578
Reference Allele: TAlternative Allele: C
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


CAATGTGGTGAACGAGTCATGTTGGATGGATTATTTTTATTTCTCTTTTTTACTAATTCCTCCGTTTCACAATATAAGACTTTTTATTATTGTCCACATA[T/C]
ATATAGATGTTAATAATCTATACACATACATGTGTCTAGATTCATTAACATATAGATACATATGTTTTACATTGTGAAACGGAGGGAGTAATTTAACTGC

Reverse complement sequence

GCAGTTAAATTACTCCCTCCGTTTCACAATGTAAAACATATGTATCTATATGTTAATGAATCTAGACACATGTATGTGTATAGATTATTAACATCTATAT[A/G]
TATGTGGACAATAATAAAAAGTCTTATATTGTGAAACGGAGGAATTAGTAAAAAAGAGAAATAAAAATAATCCATCCAACATGACTCGTTCACCACATTG

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 53.00% 15.60% 0.72% 30.68% NA
All Indica  2759 73.60% 3.40% 0.58% 22.47% NA
All Japonica  1512 14.70% 34.60% 0.13% 50.53% NA
Aus  269 68.80% 20.80% 4.83% 5.58% NA
Indica I  595 45.90% 2.20% 0.84% 51.09% NA
Indica II  465 68.00% 3.70% 0.22% 28.17% NA
Indica III  913 88.90% 3.90% 0.77% 6.35% NA
Indica Intermediate  786 80.00% 3.40% 0.38% 16.16% NA
Temperate Japonica  767 2.70% 54.00% 0.26% 43.02% NA
Tropical Japonica  504 31.50% 9.90% 0.00% 58.53% NA
Japonica Intermediate  241 17.80% 24.50% 0.00% 57.68% NA
VI/Aromatic  96 28.10% 53.10% 2.08% 16.67% NA
Intermediate  90 46.70% 13.30% 1.11% 38.89% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1125281578 T -> DEL N N silent_mutation Average:44.761; most accessible tissue: Minghui63 panicle, score: 75.788 N N N N
vg1125281578 T -> C LOC_Os11g42030.1 downstream_gene_variant ; 2843.0bp to feature; MODIFIER silent_mutation Average:44.761; most accessible tissue: Minghui63 panicle, score: 75.788 N N N N
vg1125281578 T -> C LOC_Os11g42030-LOC_Os11g42040 intergenic_region ; MODIFIER silent_mutation Average:44.761; most accessible tissue: Minghui63 panicle, score: 75.788 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1125281578 3.25E-06 NA mr1306_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125281578 4.52E-07 NA mr1733_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125281578 NA 4.20E-07 mr1733_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125281578 1.80E-06 NA mr1735_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125281578 8.71E-06 NA mr1757_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125281578 NA 7.76E-06 mr1763_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125281578 7.76E-06 NA mr1771_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125281578 NA 1.39E-07 mr1837_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125281578 3.48E-06 NA mr1866_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125281578 7.85E-07 NA mr1905_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251