\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1125281259:

Variant ID: vg1125281259 (JBrowse)Variation Type: SNP
Chromosome: chr11Position: 25281259
Reference Allele: AAlternative Allele: G
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


ATATGCATTTTTTAAGCCTAATTAGTCCATCATTTGACGATGTAGTGCTACAGTAAACATTTGCTAATAACAGATTAATTAGACTTAATAAATTTATCTC[A/G]
CAGTTTATAGGCGGAATCTATAATTTGTTTTATTATTAGTCTACATTTAATATTTTAAATATGTGTCTGTATATCCGATACGACGTACCAACCCTTTACA

Reverse complement sequence

TGTAAAGGGTTGGTACGTCGTATCGGATATACAGACACATATTTAAAATATTAAATGTAGACTAATAATAAAACAAATTATAGATTCCGCCTATAAACTG[T/C]
GAGATAAATTTATTAAGTCTAATTAATCTGTTATTAGCAAATGTTTACTGTAGCACTACATCGTCAAATGATGGACTAATTAGGCTTAAAAAATGCATAT

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 54.00% 14.40% 0.38% 31.27% NA
All Indica  2759 74.50% 3.00% 0.22% 22.29% NA
All Japonica  1512 14.80% 34.50% 0.20% 50.53% NA
Aus  269 74.70% 14.50% 3.35% 7.43% NA
Indica I  595 46.40% 2.70% 0.00% 50.92% NA
Indica II  465 69.90% 2.40% 0.22% 27.53% NA
Indica III  913 89.80% 3.40% 0.33% 6.46% NA
Indica Intermediate  786 80.70% 3.20% 0.25% 15.90% NA
Temperate Japonica  767 2.90% 54.00% 0.26% 42.89% NA
Tropical Japonica  504 31.50% 9.50% 0.00% 58.93% NA
Japonica Intermediate  241 17.80% 24.50% 0.41% 57.26% NA
VI/Aromatic  96 30.20% 22.90% 0.00% 46.88% NA
Intermediate  90 46.70% 15.60% 0.00% 37.78% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1125281259 A -> DEL N N silent_mutation Average:67.8; most accessible tissue: Callus, score: 92.332 N N N N
vg1125281259 A -> G LOC_Os11g42030.1 downstream_gene_variant ; 2524.0bp to feature; MODIFIER silent_mutation Average:67.8; most accessible tissue: Callus, score: 92.332 N N N N
vg1125281259 A -> G LOC_Os11g42030-LOC_Os11g42040 intergenic_region ; MODIFIER silent_mutation Average:67.8; most accessible tissue: Callus, score: 92.332 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1125281259 4.72E-06 NA mr1300 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125281259 4.87E-07 NA mr1745 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125281259 7.11E-06 NA mr1306_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125281259 4.14E-06 NA mr1668_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125281259 2.84E-06 NA mr1733_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125281259 8.91E-06 NA mr1735_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125281259 5.35E-06 NA mr1771_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125281259 NA 2.02E-07 mr1837_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125281259 1.47E-06 NA mr1866_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125281259 1.80E-06 NA mr1905_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251