\
| Variant ID: vg1125281259 (JBrowse) | Variation Type: SNP |
| Chromosome: chr11 | Position: 25281259 |
| Reference Allele: A | Alternative Allele: G |
| Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele: Not determined.
ATATGCATTTTTTAAGCCTAATTAGTCCATCATTTGACGATGTAGTGCTACAGTAAACATTTGCTAATAACAGATTAATTAGACTTAATAAATTTATCTC[A/G]
CAGTTTATAGGCGGAATCTATAATTTGTTTTATTATTAGTCTACATTTAATATTTTAAATATGTGTCTGTATATCCGATACGACGTACCAACCCTTTACA
TGTAAAGGGTTGGTACGTCGTATCGGATATACAGACACATATTTAAAATATTAAATGTAGACTAATAATAAAACAAATTATAGATTCCGCCTATAAACTG[T/C]
GAGATAAATTTATTAAGTCTAATTAATCTGTTATTAGCAAATGTTTACTGTAGCACTACATCGTCAAATGATGGACTAATTAGGCTTAAAAAATGCATAT
| Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 54.00% | 14.40% | 0.38% | 31.27% | NA |
| All Indica | 2759 | 74.50% | 3.00% | 0.22% | 22.29% | NA |
| All Japonica | 1512 | 14.80% | 34.50% | 0.20% | 50.53% | NA |
| Aus | 269 | 74.70% | 14.50% | 3.35% | 7.43% | NA |
| Indica I | 595 | 46.40% | 2.70% | 0.00% | 50.92% | NA |
| Indica II | 465 | 69.90% | 2.40% | 0.22% | 27.53% | NA |
| Indica III | 913 | 89.80% | 3.40% | 0.33% | 6.46% | NA |
| Indica Intermediate | 786 | 80.70% | 3.20% | 0.25% | 15.90% | NA |
| Temperate Japonica | 767 | 2.90% | 54.00% | 0.26% | 42.89% | NA |
| Tropical Japonica | 504 | 31.50% | 9.50% | 0.00% | 58.93% | NA |
| Japonica Intermediate | 241 | 17.80% | 24.50% | 0.41% | 57.26% | NA |
| VI/Aromatic | 96 | 30.20% | 22.90% | 0.00% | 46.88% | NA |
| Intermediate | 90 | 46.70% | 15.60% | 0.00% | 37.78% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1125281259 | A -> DEL | N | N | silent_mutation | Average:67.8; most accessible tissue: Callus, score: 92.332 | N | N | N | N |
| vg1125281259 | A -> G | LOC_Os11g42030.1 | downstream_gene_variant ; 2524.0bp to feature; MODIFIER | silent_mutation | Average:67.8; most accessible tissue: Callus, score: 92.332 | N | N | N | N |
| vg1125281259 | A -> G | LOC_Os11g42030-LOC_Os11g42040 | intergenic_region ; MODIFIER | silent_mutation | Average:67.8; most accessible tissue: Callus, score: 92.332 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1125281259 | 4.72E-06 | NA | mr1300 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1125281259 | 4.87E-07 | NA | mr1745 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1125281259 | 7.11E-06 | NA | mr1306_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1125281259 | 4.14E-06 | NA | mr1668_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1125281259 | 2.84E-06 | NA | mr1733_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1125281259 | 8.91E-06 | NA | mr1735_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1125281259 | 5.35E-06 | NA | mr1771_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1125281259 | NA | 2.02E-07 | mr1837_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1125281259 | 1.47E-06 | NA | mr1866_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1125281259 | 1.80E-06 | NA | mr1905_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |