\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1125279306:

Variant ID: vg1125279306 (JBrowse)Variation Type: SNP
Chromosome: chr11Position: 25279306
Reference Allele: CAlternative Allele: T
Primary Allele: TSecondary Allele: C

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


CTAACTATCCATTCTTCACACTTCATTTAATCCTAGCCATTCATCTATTTTTCTTTCCTAATCCAATTGCCAAACACACCTTATAGGATTGTCTATTTTA[C/T]
AGGAATTTTAAAAGGTACGATAGGATTCAATCATTTGTTTTAAGGGGTTTCATAGAAATTTTTTTCTATAGGATTAGAATTCTTCAAATTTCTTATGTTT

Reverse complement sequence

AAACATAAGAAATTTGAAGAATTCTAATCCTATAGAAAAAAATTTCTATGAAACCCCTTAAAACAAATGATTGAATCCTATCGTACCTTTTAAAATTCCT[G/A]
TAAAATAGACAATCCTATAAGGTGTGTTTGGCAATTGGATTAGGAAAGAAAAATAGATGAATGGCTAGGATTAAATGAAGTGTGAAGAATGGATAGTTAG

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 47.80% 15.10% 0.38% 36.71% NA
All Indica  2759 71.10% 2.50% 0.25% 26.10% NA
All Japonica  1512 14.20% 34.70% 0.60% 50.46% NA
Aus  269 16.00% 19.70% 0.37% 63.94% NA
Indica I  595 45.50% 1.50% 0.34% 52.61% NA
Indica II  465 64.10% 1.70% 0.00% 34.19% NA
Indica III  913 87.40% 3.30% 0.22% 9.09% NA
Indica Intermediate  786 75.80% 2.80% 0.38% 20.99% NA
Temperate Japonica  767 2.70% 54.20% 0.78% 42.24% NA
Tropical Japonica  504 31.20% 9.30% 0.20% 59.33% NA
Japonica Intermediate  241 15.40% 25.70% 0.83% 58.09% NA
VI/Aromatic  96 1.00% 55.20% 0.00% 43.75% NA
Intermediate  90 43.30% 13.30% 1.11% 42.22% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1125279306 C -> T LOC_Os11g42030.1 downstream_gene_variant ; 571.0bp to feature; MODIFIER silent_mutation Average:68.064; most accessible tissue: Zhenshan97 flag leaf, score: 80.588 N N N N
vg1125279306 C -> T LOC_Os11g42030-LOC_Os11g42040 intergenic_region ; MODIFIER silent_mutation Average:68.064; most accessible tissue: Zhenshan97 flag leaf, score: 80.588 N N N N
vg1125279306 C -> DEL N N silent_mutation Average:68.064; most accessible tissue: Zhenshan97 flag leaf, score: 80.588 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1125279306 NA 3.72E-08 mr1364 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125279306 NA 2.45E-07 mr1443 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125279306 NA 8.00E-07 mr1229_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125279306 7.88E-06 NA mr1306_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125279306 2.80E-06 2.79E-06 mr1463_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125279306 NA 4.03E-06 mr1555_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125279306 8.21E-06 NA mr1668_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125279306 2.75E-06 NA mr1733_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125279306 5.93E-06 NA mr1735_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125279306 NA 7.59E-07 mr1763_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125279306 9.57E-06 1.27E-08 mr1837_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125279306 2.12E-06 NA mr1866_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125279306 1.91E-06 NA mr1905_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251