\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1125279042:

Variant ID: vg1125279042 (JBrowse)Variation Type: SNP
Chromosome: chr11Position: 25279042
Reference Allele: CAlternative Allele: T
Primary Allele: TSecondary Allele: C

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


ATGTACTTATAATTTCAACAGGAAAAATGTAGGATTCTAATAGAAATGCAAGTGCAAAACAGATGATTGCAAAACAAATGAAAAACCCAGAAATGACCAT[C/T]
TGATTAAACCACCGGAAAACCAAGAATCAGATGAGATAAACTCAAAGGAAAGTTTCCAAGAAGCTGAAGCGCTTACTAAATTTTCTTCAAAATCTCTGTG

Reverse complement sequence

CACAGAGATTTTGAAGAAAATTTAGTAAGCGCTTCAGCTTCTTGGAAACTTTCCTTTGAGTTTATCTCATCTGATTCTTGGTTTTCCGGTGGTTTAATCA[G/A]
ATGGTCATTTCTGGGTTTTTCATTTGTTTTGCAATCATCTGTTTTGCACTTGCATTTCTATTAGAATCCTACATTTTTCCTGTTGAAATTATAAGTACAT

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 47.80% 15.00% 0.25% 36.97% NA
All Indica  2759 71.10% 2.50% 0.22% 26.21% NA
All Japonica  1512 14.20% 34.60% 0.33% 50.86% NA
Aus  269 16.00% 19.70% 0.37% 63.94% NA
Indica I  595 45.20% 1.50% 0.50% 52.77% NA
Indica II  465 63.90% 1.70% 0.00% 34.41% NA
Indica III  913 87.40% 3.30% 0.22% 9.09% NA
Indica Intermediate  786 76.00% 2.80% 0.13% 21.12% NA
Temperate Japonica  767 2.70% 54.10% 0.39% 42.76% NA
Tropical Japonica  504 31.20% 9.50% 0.20% 59.13% NA
Japonica Intermediate  241 15.40% 24.90% 0.41% 59.34% NA
VI/Aromatic  96 1.00% 53.10% 0.00% 45.83% NA
Intermediate  90 42.20% 14.40% 0.00% 43.33% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1125279042 C -> T LOC_Os11g42030.1 downstream_gene_variant ; 307.0bp to feature; MODIFIER silent_mutation Average:53.299; most accessible tissue: Callus, score: 77.866 N N N N
vg1125279042 C -> T LOC_Os11g42030-LOC_Os11g42040 intergenic_region ; MODIFIER silent_mutation Average:53.299; most accessible tissue: Callus, score: 77.866 N N N N
vg1125279042 C -> DEL N N silent_mutation Average:53.299; most accessible tissue: Callus, score: 77.866 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1125279042 2.09E-06 NA mr1745 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125279042 3.97E-06 NA mr1306_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125279042 3.37E-06 NA mr1733_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125279042 4.80E-06 NA mr1735_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125279042 NA 2.53E-06 mr1763_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125279042 NA 1.08E-07 mr1837_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125279042 2.35E-06 NA mr1866_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125279042 6.82E-06 NA mr1905_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251