\
| Variant ID: vg1125279042 (JBrowse) | Variation Type: SNP |
| Chromosome: chr11 | Position: 25279042 |
| Reference Allele: C | Alternative Allele: T |
| Primary Allele: T | Secondary Allele: C |
Inferred Ancestral Allele: Not determined.
ATGTACTTATAATTTCAACAGGAAAAATGTAGGATTCTAATAGAAATGCAAGTGCAAAACAGATGATTGCAAAACAAATGAAAAACCCAGAAATGACCAT[C/T]
TGATTAAACCACCGGAAAACCAAGAATCAGATGAGATAAACTCAAAGGAAAGTTTCCAAGAAGCTGAAGCGCTTACTAAATTTTCTTCAAAATCTCTGTG
CACAGAGATTTTGAAGAAAATTTAGTAAGCGCTTCAGCTTCTTGGAAACTTTCCTTTGAGTTTATCTCATCTGATTCTTGGTTTTCCGGTGGTTTAATCA[G/A]
ATGGTCATTTCTGGGTTTTTCATTTGTTTTGCAATCATCTGTTTTGCACTTGCATTTCTATTAGAATCCTACATTTTTCCTGTTGAAATTATAAGTACAT
| Populations | Population Size | Frequency of T(primary allele) | Frequency of C(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 47.80% | 15.00% | 0.25% | 36.97% | NA |
| All Indica | 2759 | 71.10% | 2.50% | 0.22% | 26.21% | NA |
| All Japonica | 1512 | 14.20% | 34.60% | 0.33% | 50.86% | NA |
| Aus | 269 | 16.00% | 19.70% | 0.37% | 63.94% | NA |
| Indica I | 595 | 45.20% | 1.50% | 0.50% | 52.77% | NA |
| Indica II | 465 | 63.90% | 1.70% | 0.00% | 34.41% | NA |
| Indica III | 913 | 87.40% | 3.30% | 0.22% | 9.09% | NA |
| Indica Intermediate | 786 | 76.00% | 2.80% | 0.13% | 21.12% | NA |
| Temperate Japonica | 767 | 2.70% | 54.10% | 0.39% | 42.76% | NA |
| Tropical Japonica | 504 | 31.20% | 9.50% | 0.20% | 59.13% | NA |
| Japonica Intermediate | 241 | 15.40% | 24.90% | 0.41% | 59.34% | NA |
| VI/Aromatic | 96 | 1.00% | 53.10% | 0.00% | 45.83% | NA |
| Intermediate | 90 | 42.20% | 14.40% | 0.00% | 43.33% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1125279042 | C -> T | LOC_Os11g42030.1 | downstream_gene_variant ; 307.0bp to feature; MODIFIER | silent_mutation | Average:53.299; most accessible tissue: Callus, score: 77.866 | N | N | N | N |
| vg1125279042 | C -> T | LOC_Os11g42030-LOC_Os11g42040 | intergenic_region ; MODIFIER | silent_mutation | Average:53.299; most accessible tissue: Callus, score: 77.866 | N | N | N | N |
| vg1125279042 | C -> DEL | N | N | silent_mutation | Average:53.299; most accessible tissue: Callus, score: 77.866 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1125279042 | 2.09E-06 | NA | mr1745 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1125279042 | 3.97E-06 | NA | mr1306_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1125279042 | 3.37E-06 | NA | mr1733_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1125279042 | 4.80E-06 | NA | mr1735_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1125279042 | NA | 2.53E-06 | mr1763_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1125279042 | NA | 1.08E-07 | mr1837_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1125279042 | 2.35E-06 | NA | mr1866_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1125279042 | 6.82E-06 | NA | mr1905_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |