\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1125264481:

Variant ID: vg1125264481 (JBrowse)Variation Type: SNP
Chromosome: chr11Position: 25264481
Reference Allele: AAlternative Allele: G
Primary Allele: ASecondary Allele: G

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 1.00, others allele: 0.00, population size: 84. )

Flanking Sequence (100 bp) in Reference Genome:


CTGAAAAGTTGTGTGTGTATGACACGTTGATGTGATGGAAAAGGACGGAAGTTTAGATCCAAACTTTGGATCTAAATACAGCCATAGTCTATTGAGGTCT[A/G]
GCAGTGATTGAAGCTCTGACATTGCACTACTACCAATGTTGGGGACAAAGTAACCAAGCAATGTGTGAAGATGTGTAAGTTGGCCCATAGCATGAGGCAT

Reverse complement sequence

ATGCCTCATGCTATGGGCCAACTTACACATCTTCACACATTGCTTGGTTACTTTGTCCCCAACATTGGTAGTAGTGCAATGTCAGAGCTTCAATCACTGC[T/C]
AGACCTCAATAGACTATGGCTGTATTTAGATCCAAAGTTTGGATCTAAACTTCCGTCCTTTTCCATCACATCAACGTGTCATACACACACAACTTTTCAG

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 62.10% 37.70% 0.21% 0.00% NA
All Indica  2759 73.20% 26.60% 0.22% 0.00% NA
All Japonica  1512 47.90% 51.80% 0.26% 0.00% NA
Aus  269 33.50% 66.50% 0.00% 0.00% NA
Indica I  595 47.20% 52.80% 0.00% 0.00% NA
Indica II  465 63.40% 35.70% 0.86% 0.00% NA
Indica III  913 90.40% 9.60% 0.00% 0.00% NA
Indica Intermediate  786 78.80% 21.00% 0.25% 0.00% NA
Temperate Japonica  767 55.80% 44.10% 0.13% 0.00% NA
Tropical Japonica  504 40.10% 59.50% 0.40% 0.00% NA
Japonica Intermediate  241 39.40% 60.20% 0.41% 0.00% NA
VI/Aromatic  96 51.00% 49.00% 0.00% 0.00% NA
Intermediate  90 55.60% 44.40% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1125264481 A -> G LOC_Os11g42010.1 upstream_gene_variant ; 205.0bp to feature; MODIFIER silent_mutation Average:73.193; most accessible tissue: Callus, score: 95.937 N N N N
vg1125264481 A -> G LOC_Os11g42000.1 downstream_gene_variant ; 1908.0bp to feature; MODIFIER silent_mutation Average:73.193; most accessible tissue: Callus, score: 95.937 N N N N
vg1125264481 A -> G LOC_Os11g42020.1 downstream_gene_variant ; 2886.0bp to feature; MODIFIER silent_mutation Average:73.193; most accessible tissue: Callus, score: 95.937 N N N N
vg1125264481 A -> G LOC_Os11g42010-LOC_Os11g42020 intergenic_region ; MODIFIER silent_mutation Average:73.193; most accessible tissue: Callus, score: 95.937 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg1125264481 A G 0.03 0.02 0.02 0.03 0.04 0.04

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1125264481 8.12E-07 NA mr1133 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125264481 NA 1.73E-07 mr1133 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125264481 NA 7.54E-07 mr1191 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125264481 NA 2.72E-06 mr1484 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125264481 9.62E-06 NA mr1530 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125264481 NA 5.27E-07 mr1530 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125264481 NA 6.24E-06 mr1644 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125264481 1.15E-11 5.39E-17 mr1662 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125264481 4.25E-13 7.85E-18 mr1662 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125264481 1.90E-08 NA mr1745 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125264481 NA 2.01E-07 mr1745 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125264481 NA 4.77E-06 mr1904 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125264481 3.05E-07 5.34E-15 mr1133_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125264481 NA 1.27E-08 mr1133_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125264481 NA 1.32E-11 mr1191_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125264481 1.34E-07 NA mr1530_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125264481 NA 1.04E-07 mr1530_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125264481 NA 3.84E-06 mr1543_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125264481 1.07E-10 3.13E-16 mr1662_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125264481 5.00E-14 2.29E-20 mr1662_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125264481 NA 7.62E-06 mr1667_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125264481 NA 1.25E-07 mr1745_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251