\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1125263882:

Variant ID: vg1125263882 (JBrowse)Variation Type: SNP
Chromosome: chr11Position: 25263882
Reference Allele: AAlternative Allele: G
Primary Allele: ASecondary Allele: G

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.73, G: 0.27, others allele: 0.00, population size: 103. )

Flanking Sequence (100 bp) in Reference Genome:


TGAATGATGACAAGTTCTGCAAGACGAGGAAACAGATTCATCCTAGATGACTGTTCCCAGACTTCAAGGCTAGTCATGAATGAGAGAATCAGCTTCTCCA[A/G]
TGAAGGAAATGTACCGTTCTGACCATAGAAATTATCGTCAATACAACTGATATTCTCAACTCGGCTTATCTCCACTTCCTCGCAAAAAAAAAAAAACTCG

Reverse complement sequence

CGAGTTTTTTTTTTTTTGCGAGGAAGTGGAGATAAGCCGAGTTGAGAATATCAGTTGTATTGACGATAATTTCTATGGTCAGAACGGTACATTTCCTTCA[T/C]
TGGAGAAGCTGATTCTCTCATTCATGACTAGCCTTGAAGTCTGGGAACAGTCATCTAGGATGAATCTGTTTCCTCGTCTTGCAGAACTTGTCATCATTCA

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 62.00% 28.50% 0.72% 8.76% NA
All Indica  2759 73.20% 17.90% 0.62% 8.34% NA
All Japonica  1512 47.80% 39.60% 0.93% 11.64% NA
Aus  269 33.50% 66.20% 0.37% 0.00% NA
Indica I  595 47.20% 27.70% 1.01% 24.03% NA
Indica II  465 63.70% 23.20% 0.86% 12.26% NA
Indica III  913 90.40% 9.60% 0.00% 0.00% NA
Indica Intermediate  786 78.50% 16.80% 0.89% 3.82% NA
Temperate Japonica  767 55.80% 22.40% 1.56% 20.21% NA
Tropical Japonica  504 39.90% 59.10% 0.40% 0.60% NA
Japonica Intermediate  241 39.00% 53.50% 0.00% 7.47% NA
VI/Aromatic  96 51.00% 49.00% 0.00% 0.00% NA
Intermediate  90 55.60% 33.30% 2.22% 8.89% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1125263882 A -> DEL N N silent_mutation Average:70.509; most accessible tissue: Zhenshan97 flower, score: 84.598 N N N N
vg1125263882 A -> G LOC_Os11g42000.1 downstream_gene_variant ; 1309.0bp to feature; MODIFIER silent_mutation Average:70.509; most accessible tissue: Zhenshan97 flower, score: 84.598 N N N N
vg1125263882 A -> G LOC_Os11g42020.1 downstream_gene_variant ; 3485.0bp to feature; MODIFIER silent_mutation Average:70.509; most accessible tissue: Zhenshan97 flower, score: 84.598 N N N N
vg1125263882 A -> G LOC_Os11g42010.1 intron_variant ; MODIFIER silent_mutation Average:70.509; most accessible tissue: Zhenshan97 flower, score: 84.598 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1125263882 5.40E-06 NA mr1133 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125263882 NA 2.35E-07 mr1191 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125263882 NA 7.10E-07 mr1484 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125263882 3.63E-07 NA mr1530 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125263882 6.65E-07 1.56E-08 mr1530 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125263882 NA 1.07E-06 mr1644 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125263882 1.62E-13 9.30E-19 mr1662 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125263882 6.60E-15 1.31E-19 mr1662 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125263882 8.95E-09 NA mr1745 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125263882 NA 5.63E-08 mr1745 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125263882 NA 5.18E-07 mr1904 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125263882 3.28E-06 NA mr1133_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125263882 NA 1.15E-07 mr1133_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125263882 1.92E-06 7.00E-13 mr1191_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125263882 2.55E-08 NA mr1530_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125263882 NA 1.15E-08 mr1530_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125263882 NA 2.73E-06 mr1543_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125263882 1.12E-12 2.65E-18 mr1662_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125263882 6.16E-16 1.51E-22 mr1662_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125263882 NA 8.18E-06 mr1667_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125263882 8.88E-06 NA mr1745_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125263882 NA 1.48E-08 mr1745_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125263882 NA 5.80E-06 mr1841_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251