\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1125263550:

Variant ID: vg1125263550 (JBrowse)Variation Type: SNP
Chromosome: chr11Position: 25263550
Reference Allele: CAlternative Allele: T
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.92, T: 0.09, others allele: 0.00, population size: 268. )

Flanking Sequence (100 bp) in Reference Genome:


GGTTCTCCAACCATTCTGGCAAAATCTCCAATTTGTTGCAGTTATCAATTTTCAAGCTGGCGAGAGAGGAAAGATGCTGCAAACCCTGTGGGAGGCATGA[C/T]
AATTCATGACAACCACATATCTCCAACTTCTTGAGGCGATCAAGAGCCTGTAGACCCTCACAGCCTGAAGAAGCATGCAACTCTTCACAGAAAGAAATTG

Reverse complement sequence

CAATTTCTTTCTGTGAAGAGTTGCATGCTTCTTCAGGCTGTGAGGGTCTACAGGCTCTTGATCGCCTCAAGAAGTTGGAGATATGTGGTTGTCATGAATT[G/A]
TCATGCCTCCCACAGGGTTTGCAGCATCTTTCCTCTCTCGCCAGCTTGAAAATTGATAACTGCAACAAATTGGAGATTTTGCCAGAATGGTTGGAGAACC

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 84.10% 6.60% 1.06% 8.17% NA
All Indica  2759 84.40% 7.80% 0.25% 7.54% NA
All Japonica  1512 82.90% 3.80% 2.65% 10.65% NA
Aus  269 85.10% 10.40% 0.37% 4.09% NA
Indica I  595 54.80% 23.50% 0.34% 21.34% NA
Indica II  465 79.40% 8.40% 0.86% 11.40% NA
Indica III  913 99.00% 1.00% 0.00% 0.00% NA
Indica Intermediate  786 92.90% 3.40% 0.13% 3.56% NA
Temperate Japonica  767 71.10% 6.30% 3.91% 18.77% NA
Tropical Japonica  504 98.60% 0.20% 0.20% 0.99% NA
Japonica Intermediate  241 88.00% 3.30% 3.73% 4.98% NA
VI/Aromatic  96 100.00% 0.00% 0.00% 0.00% NA
Intermediate  90 75.60% 15.60% 2.22% 6.67% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1125263550 C -> T LOC_Os11g42010.1 synonymous_variant ; p.Leu172Leu; LOW synonymous_codon Average:79.687; most accessible tissue: Callus, score: 89.572 N N N N
vg1125263550 C -> DEL LOC_Os11g42010.1 N frameshift_variant Average:79.687; most accessible tissue: Callus, score: 89.572 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg1125263550 C T -0.02 -0.02 -0.02 -0.03 -0.03 -0.04

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1125263550 NA 1.35E-09 mr1191 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125263550 1.26E-11 1.90E-13 mr1191 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125263550 NA 7.49E-06 mr1291 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125263550 1.16E-06 NA mr1484 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125263550 1.24E-10 5.26E-15 mr1530 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125263550 9.93E-08 1.59E-10 mr1530 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125263550 1.45E-06 2.23E-09 mr1530 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125263550 NA 4.25E-10 mr1644 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125263550 1.15E-12 1.58E-15 mr1644 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125263550 NA 4.46E-07 mr1662 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125263550 2.19E-09 1.74E-15 mr1662 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125263550 1.27E-11 NA mr1745 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125263550 1.32E-07 2.36E-12 mr1745 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125263550 1.35E-06 NA mr1745 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125263550 NA 4.37E-16 mr1191_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125263550 1.62E-14 1.30E-22 mr1191_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125263550 4.42E-11 4.69E-18 mr1530_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125263550 6.19E-07 1.40E-12 mr1530_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125263550 1.58E-08 6.99E-14 mr1530_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125263550 NA 1.57E-06 mr1662_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125263550 2.83E-09 2.31E-17 mr1662_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125263550 5.39E-08 NA mr1745_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125263550 8.13E-07 1.63E-16 mr1745_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251