\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1125263117:

Variant ID: vg1125263117 (JBrowse)Variation Type: SNP
Chromosome: chr11Position: 25263117
Reference Allele: CAlternative Allele: G
Primary Allele: GSecondary Allele: C

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.98, C: 0.02, others allele: 0.00, population size: 281. )

Flanking Sequence (100 bp) in Reference Genome:


ATTGGCCTTCCCTTAAATCGCTGAACTAATGTAAAACTAATCTTCCATGACGACTATTCGTTTGCCCTCGTGCAGCTGTTTTTCACACAATAATAAGTCA[C/G]
AAGTGTTGAAAGAAACAACTTCATATCGTGCCAATTCAACTCAAGAGGATATGTATTAATAACTGAACATGAGTTCATTCACTTGAACATCAAAAAGAAA

Reverse complement sequence

TTTCTTTTTGATGTTCAAGTGAATGAACTCATGTTCAGTTATTAATACATATCCTCTTGAGTTGAATTGGCACGATATGAAGTTGTTTCTTTCAACACTT[G/C]
TGACTTATTATTGTGTGAAAAACAGCTGCACGAGGGCAAACGAATAGTCGTCATGGAAGATTAGTTTTACATTAGTTCAGCGATTTAAGGGAAGGCCAAT

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 85.30% 14.60% 0.08% 0.00% NA
All Indica  2759 97.60% 2.40% 0.07% 0.00% NA
All Japonica  1512 65.90% 34.00% 0.13% 0.00% NA
Aus  269 81.00% 19.00% 0.00% 0.00% NA
Indica I  595 98.70% 1.30% 0.00% 0.00% NA
Indica II  465 98.30% 1.50% 0.22% 0.00% NA
Indica III  913 96.70% 3.30% 0.00% 0.00% NA
Indica Intermediate  786 97.30% 2.50% 0.13% 0.00% NA
Temperate Japonica  767 46.50% 53.20% 0.26% 0.00% NA
Tropical Japonica  504 90.50% 9.50% 0.00% 0.00% NA
Japonica Intermediate  241 75.90% 24.10% 0.00% 0.00% NA
VI/Aromatic  96 47.90% 52.10% 0.00% 0.00% NA
Intermediate  90 88.90% 11.10% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1125263117 C -> G LOC_Os11g42000.1 downstream_gene_variant ; 544.0bp to feature; MODIFIER silent_mutation Average:57.071; most accessible tissue: Minghui63 root, score: 76.119 N N N N
vg1125263117 C -> G LOC_Os11g42010.1 downstream_gene_variant ; 139.0bp to feature; MODIFIER silent_mutation Average:57.071; most accessible tissue: Minghui63 root, score: 76.119 N N N N
vg1125263117 C -> G LOC_Os11g42020.1 downstream_gene_variant ; 4250.0bp to feature; MODIFIER silent_mutation Average:57.071; most accessible tissue: Minghui63 root, score: 76.119 N N N N
vg1125263117 C -> G LOC_Os11g42000-LOC_Os11g42010 intergenic_region ; MODIFIER silent_mutation Average:57.071; most accessible tissue: Minghui63 root, score: 76.119 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1125263117 NA 5.34E-08 mr1364 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125263117 NA 4.58E-07 mr1443 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125263117 2.17E-10 NA mr1745 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125263117 2.02E-06 7.07E-06 mr1745 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125263117 4.72E-06 NA mr1530_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125263117 NA 5.23E-06 mr1555_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125263117 6.51E-07 NA mr1745_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125263117 NA 8.74E-06 mr1763_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251