\
| Variant ID: vg1125263117 (JBrowse) | Variation Type: SNP |
| Chromosome: chr11 | Position: 25263117 |
| Reference Allele: C | Alternative Allele: G |
| Primary Allele: G | Secondary Allele: C |
Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.98, C: 0.02, others allele: 0.00, population size: 281. )
ATTGGCCTTCCCTTAAATCGCTGAACTAATGTAAAACTAATCTTCCATGACGACTATTCGTTTGCCCTCGTGCAGCTGTTTTTCACACAATAATAAGTCA[C/G]
AAGTGTTGAAAGAAACAACTTCATATCGTGCCAATTCAACTCAAGAGGATATGTATTAATAACTGAACATGAGTTCATTCACTTGAACATCAAAAAGAAA
TTTCTTTTTGATGTTCAAGTGAATGAACTCATGTTCAGTTATTAATACATATCCTCTTGAGTTGAATTGGCACGATATGAAGTTGTTTCTTTCAACACTT[G/C]
TGACTTATTATTGTGTGAAAAACAGCTGCACGAGGGCAAACGAATAGTCGTCATGGAAGATTAGTTTTACATTAGTTCAGCGATTTAAGGGAAGGCCAAT
| Populations | Population Size | Frequency of G(primary allele) | Frequency of C(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 85.30% | 14.60% | 0.08% | 0.00% | NA |
| All Indica | 2759 | 97.60% | 2.40% | 0.07% | 0.00% | NA |
| All Japonica | 1512 | 65.90% | 34.00% | 0.13% | 0.00% | NA |
| Aus | 269 | 81.00% | 19.00% | 0.00% | 0.00% | NA |
| Indica I | 595 | 98.70% | 1.30% | 0.00% | 0.00% | NA |
| Indica II | 465 | 98.30% | 1.50% | 0.22% | 0.00% | NA |
| Indica III | 913 | 96.70% | 3.30% | 0.00% | 0.00% | NA |
| Indica Intermediate | 786 | 97.30% | 2.50% | 0.13% | 0.00% | NA |
| Temperate Japonica | 767 | 46.50% | 53.20% | 0.26% | 0.00% | NA |
| Tropical Japonica | 504 | 90.50% | 9.50% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 75.90% | 24.10% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 47.90% | 52.10% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 88.90% | 11.10% | 0.00% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1125263117 | C -> G | LOC_Os11g42000.1 | downstream_gene_variant ; 544.0bp to feature; MODIFIER | silent_mutation | Average:57.071; most accessible tissue: Minghui63 root, score: 76.119 | N | N | N | N |
| vg1125263117 | C -> G | LOC_Os11g42010.1 | downstream_gene_variant ; 139.0bp to feature; MODIFIER | silent_mutation | Average:57.071; most accessible tissue: Minghui63 root, score: 76.119 | N | N | N | N |
| vg1125263117 | C -> G | LOC_Os11g42020.1 | downstream_gene_variant ; 4250.0bp to feature; MODIFIER | silent_mutation | Average:57.071; most accessible tissue: Minghui63 root, score: 76.119 | N | N | N | N |
| vg1125263117 | C -> G | LOC_Os11g42000-LOC_Os11g42010 | intergenic_region ; MODIFIER | silent_mutation | Average:57.071; most accessible tissue: Minghui63 root, score: 76.119 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1125263117 | NA | 5.34E-08 | mr1364 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1125263117 | NA | 4.58E-07 | mr1443 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1125263117 | 2.17E-10 | NA | mr1745 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1125263117 | 2.02E-06 | 7.07E-06 | mr1745 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1125263117 | 4.72E-06 | NA | mr1530_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1125263117 | NA | 5.23E-06 | mr1555_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1125263117 | 6.51E-07 | NA | mr1745_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1125263117 | NA | 8.74E-06 | mr1763_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |