Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1125263117:

Variant ID: vg1125263117 (JBrowse)	Variation Type: SNP
Chromosome: chr11	Position: 25263117
Reference Allele: C	Alternative Allele: G
Primary Allele: G	Secondary Allele: C

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.98, C: 0.02, others allele: 0.00, population size: 281. )

Flanking Sequence (100 bp) in Reference Genome:

ATTGGCCTTCCCTTAAATCGCTGAACTAATGTAAAACTAATCTTCCATGACGACTATTCGTTTGCCCTCGTGCAGCTGTTTTTCACACAATAATAAGTCA[C/G]
AAGTGTTGAAAGAAACAACTTCATATCGTGCCAATTCAACTCAAGAGGATATGTATTAATAACTGAACATGAGTTCATTCACTTGAACATCAAAAAGAAA

Reverse complement sequence

TTTCTTTTTGATGTTCAAGTGAATGAACTCATGTTCAGTTATTAATACATATCCTCTTGAGTTGAATTGGCACGATATGAAGTTGTTTCTTTCAACACTT[G/C]
TGACTTATTATTGTGTGAAAAACAGCTGCACGAGGGCAAACGAATAGTCGTCATGGAAGATTAGTTTTACATTAGTTCAGCGATTTAAGGGAAGGCCAAT

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of C(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	85.30%	14.60%	0.08%	0.00%	NA
All Indica	2759	97.60%	2.40%	0.07%	0.00%	NA
All Japonica	1512	65.90%	34.00%	0.13%	0.00%	NA
Aus	269	81.00%	19.00%	0.00%	0.00%	NA
Indica I	595	98.70%	1.30%	0.00%	0.00%	NA
Indica II	465	98.30%	1.50%	0.22%	0.00%	NA
Indica III	913	96.70%	3.30%	0.00%	0.00%	NA
Indica Intermediate	786	97.30%	2.50%	0.13%	0.00%	NA
Temperate Japonica	767	46.50%	53.20%	0.26%	0.00%	NA
Tropical Japonica	504	90.50%	9.50%	0.00%	0.00%	NA
Japonica Intermediate	241	75.90%	24.10%	0.00%	0.00%	NA
VI/Aromatic	96	47.90%	52.10%	0.00%	0.00%	NA
Intermediate	90	88.90%	11.10%	0.00%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1125263117	C -> G	LOC_Os11g42000.1	downstream_gene_variant ; 544.0bp to feature; MODIFIER	silent_mutation	Average:57.071; most accessible tissue: Minghui63 root, score: 76.119	N	N	N	N
vg1125263117	C -> G	LOC_Os11g42010.1	downstream_gene_variant ; 139.0bp to feature; MODIFIER	silent_mutation	Average:57.071; most accessible tissue: Minghui63 root, score: 76.119	N	N	N	N
vg1125263117	C -> G	LOC_Os11g42020.1	downstream_gene_variant ; 4250.0bp to feature; MODIFIER	silent_mutation	Average:57.071; most accessible tissue: Minghui63 root, score: 76.119	N	N	N	N
vg1125263117	C -> G	LOC_Os11g42000-LOC_Os11g42010	intergenic_region ; MODIFIER	silent_mutation	Average:57.071; most accessible tissue: Minghui63 root, score: 76.119	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1125263117	NA	5.34E-08	mr1364	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125263117	NA	4.58E-07	mr1443	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125263117	2.17E-10	NA	mr1745	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125263117	2.02E-06	7.07E-06	mr1745	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125263117	4.72E-06	NA	mr1530_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125263117	NA	5.23E-06	mr1555_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125263117	6.51E-07	NA	mr1745_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125263117	NA	8.74E-06	mr1763_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251