Variant ID: vg1125261664 (JBrowse) | Variation Type: SNP |
Chromosome: chr11 | Position: 25261664 |
Reference Allele: G | Alternative Allele: T |
Primary Allele: G | Secondary Allele: T |
Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 1.00, others allele: 0.00, population size: 281. )
CACTATTTCTTTTCTTGTATTTATCTTGCTGATCTTGGTATTCATACATTTTGCATCCCAACTATTTTGCTCTGGCCCATCCTCTCTCTAGTCTTCTCTT[G/T]
CCATTTTTGTTCAACCAAATATTCAATTGATTATTGATTGTTGTACATTATGAAAGATGTGCAGAAAAGCTTGCTTATAAGAGGCAAAAGGAGAAGGAAA
TTTCCTTCTCCTTTTGCCTCTTATAAGCAAGCTTTTCTGCACATCTTTCATAATGTACAACAATCAATAATCAATTGAATATTTGGTTGAACAAAAATGG[C/A]
AAGAGAAGACTAGAGAGAGGATGGGCCAGAGCAAAATAGTTGGGATGCAAAATGTATGAATACCAAGATCAGCAAGATAAATACAAGAAAAGAAATAGTG
Populations | Population Size | Frequency of G(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
---|---|---|---|---|---|---|
All | 4726 | 85.40% | 14.60% | 0.06% | 0.00% | NA |
All Indica | 2759 | 75.70% | 24.20% | 0.07% | 0.00% | NA |
All Japonica | 1512 | 99.00% | 0.90% | 0.07% | 0.00% | NA |
Aus | 269 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
Indica I | 595 | 66.70% | 33.30% | 0.00% | 0.00% | NA |
Indica II | 465 | 96.80% | 3.00% | 0.22% | 0.00% | NA |
Indica III | 913 | 70.60% | 29.20% | 0.11% | 0.00% | NA |
Indica Intermediate | 786 | 75.80% | 24.20% | 0.00% | 0.00% | NA |
Temperate Japonica | 767 | 98.70% | 1.30% | 0.00% | 0.00% | NA |
Tropical Japonica | 504 | 99.80% | 0.20% | 0.00% | 0.00% | NA |
Japonica Intermediate | 241 | 98.30% | 1.20% | 0.41% | 0.00% | NA |
VI/Aromatic | 96 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
Intermediate | 90 | 94.40% | 5.60% | 0.00% | 0.00% | NA |
Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
---|---|---|---|---|---|---|---|---|---|
vg1125261664 | G -> T | LOC_Os11g42010.1 | downstream_gene_variant ; 1592.0bp to feature; MODIFIER | silent_mutation | Average:52.024; most accessible tissue: Zhenshan97 root, score: 63.237 | N | N | N | N |
vg1125261664 | G -> T | LOC_Os11g42000.1 | intron_variant ; MODIFIER | silent_mutation | Average:52.024; most accessible tissue: Zhenshan97 root, score: 63.237 | N | N | N | N |
Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
---|---|---|---|---|---|---|
vg1125261664 | 1.04E-06 | NA | mr1191 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg1125261664 | 1.57E-06 | 1.20E-07 | mr1191 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg1125261664 | 2.38E-08 | NA | mr1644 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg1125261664 | 6.46E-08 | 1.73E-08 | mr1644 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg1125261664 | 1.19E-09 | NA | mr1191_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg1125261664 | 3.44E-09 | 2.10E-09 | mr1191_2 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |