\
| Variant ID: vg1125259799 (JBrowse) | Variation Type: SNP |
| Chromosome: chr11 | Position: 25259799 |
| Reference Allele: G | Alternative Allele: A |
| Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.90, A: 0.09, others allele: 0.00, population size: 232. )
TTGGTGGTGTGTTCCTTACATTCTTTTCATTAAGGGTACAGTGTATATTTCTTCAGAAATTTTCTGTAACATGTTCTGATTTGTGGAGCTGAGGTGATTT[G/A]
GCAAGTTCATCCCATTTTATTCTGAGCAATACTGCAAATGTATTGAAGACTGAAGAGCTTGATATAATAGACTAATTGGGTATGAACTGTAGATATTATC
GATAATATCTACAGTTCATACCCAATTAGTCTATTATATCAAGCTCTTCAGTCTTCAATACATTTGCAGTATTGCTCAGAATAAAATGGGATGAACTTGC[C/T]
AAATCACCTCAGCTCCACAAATCAGAACATGTTACAGAAAATTTCTGAAGAAATATACACTGTACCCTTAATGAAAAGAATGTAAGGAACACACCACCAA
| Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 80.10% | 19.90% | 0.02% | 0.00% | NA |
| All Indica | 2759 | 79.60% | 20.40% | 0.04% | 0.00% | NA |
| All Japonica | 1512 | 82.50% | 17.50% | 0.00% | 0.00% | NA |
| Aus | 269 | 66.50% | 33.50% | 0.00% | 0.00% | NA |
| Indica I | 595 | 48.40% | 51.60% | 0.00% | 0.00% | NA |
| Indica II | 465 | 78.90% | 20.90% | 0.22% | 0.00% | NA |
| Indica III | 913 | 92.70% | 7.30% | 0.00% | 0.00% | NA |
| Indica Intermediate | 786 | 88.30% | 11.70% | 0.00% | 0.00% | NA |
| Temperate Japonica | 767 | 70.40% | 29.60% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 98.40% | 1.60% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 88.00% | 12.00% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 75.60% | 24.40% | 0.00% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1125259799 | G -> A | LOC_Os11g42010.1 | downstream_gene_variant ; 3457.0bp to feature; MODIFIER | silent_mutation | Average:46.51; most accessible tissue: Callus, score: 72.92 | N | N | N | N |
| vg1125259799 | G -> A | LOC_Os11g42000.1 | intron_variant ; MODIFIER | silent_mutation | Average:46.51; most accessible tissue: Callus, score: 72.92 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1125259799 | 6.00E-06 | 4.16E-09 | mr1191 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1125259799 | NA | 5.01E-06 | mr1291 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1125259799 | 2.44E-06 | NA | mr1484 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1125259799 | 4.54E-11 | 1.36E-13 | mr1530 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1125259799 | 7.00E-09 | 3.32E-11 | mr1530 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1125259799 | 6.47E-07 | 1.08E-09 | mr1530 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1125259799 | 3.30E-06 | 9.81E-11 | mr1644 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1125259799 | NA | 3.52E-07 | mr1662 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1125259799 | 4.90E-08 | 4.09E-14 | mr1662 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1125259799 | 1.78E-09 | NA | mr1745 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1125259799 | 1.63E-06 | 2.32E-10 | mr1745 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1125259799 | 8.36E-07 | NA | mr1745 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1125259799 | NA | 1.67E-07 | mr1904 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1125259799 | 8.44E-09 | 5.19E-18 | mr1191_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1125259799 | 6.71E-10 | NA | mr1530_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1125259799 | 3.30E-06 | 2.47E-10 | mr1530_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1125259799 | 2.29E-08 | 1.06E-13 | mr1530_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1125259799 | NA | 5.81E-07 | mr1543_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1125259799 | 3.69E-08 | 1.62E-15 | mr1662_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1125259799 | 4.17E-06 | NA | mr1745_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1125259799 | NA | 3.53E-13 | mr1745_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |