\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1125259232:

Variant ID: vg1125259232 (JBrowse)Variation Type: SNP
Chromosome: chr11Position: 25259232
Reference Allele: AAlternative Allele: G
Primary Allele: ASecondary Allele: G

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.80, G: 0.20, others allele: 0.00, population size: 227. )

Flanking Sequence (100 bp) in Reference Genome:


CATTATAAAAGTCAAGTGACTTGGATTCTATTGCTTGTGTTAGTAAAGTACAAGGAAGCTTTTGTTTTAGATATGTAAGTGGAAACTACTATGATAAATG[A/G]
AGAACCAGAATGTAGCCTCACCACAGCATCCTTTATCGTGGATGTATAAATAATTGTGGATTGGAGATCATGTTCATGTTTACAAAATTATTGTTTCATT

Reverse complement sequence

AATGAAACAATAATTTTGTAAACATGAACATGATCTCCAATCCACAATTATTTATACATCCACGATAAAGGATGCTGTGGTGAGGCTACATTCTGGTTCT[T/C]
CATTTATCATAGTAGTTTCCACTTACATATCTAAAACAAAAGCTTCCTTGTACTTTACTAACACAAGCAATAGAATCCAAGTCACTTGACTTTTATAATG

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 70.30% 29.60% 0.08% 0.00% NA
All Indica  2759 65.40% 34.50% 0.11% 0.00% NA
All Japonica  1512 79.80% 20.10% 0.07% 0.00% NA
Aus  269 58.40% 41.60% 0.00% 0.00% NA
Indica I  595 46.40% 53.40% 0.17% 0.00% NA
Indica II  465 28.20% 71.80% 0.00% 0.00% NA
Indica III  913 91.90% 8.10% 0.00% 0.00% NA
Indica Intermediate  786 71.10% 28.60% 0.25% 0.00% NA
Temperate Japonica  767 70.10% 29.70% 0.13% 0.00% NA
Tropical Japonica  504 94.20% 5.80% 0.00% 0.00% NA
Japonica Intermediate  241 80.50% 19.50% 0.00% 0.00% NA
VI/Aromatic  96 97.90% 2.10% 0.00% 0.00% NA
Intermediate  90 64.40% 35.60% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1125259232 A -> G LOC_Os11g42010.1 downstream_gene_variant ; 4024.0bp to feature; MODIFIER silent_mutation Average:50.692; most accessible tissue: Callus, score: 77.142 N N N N
vg1125259232 A -> G LOC_Os11g42000.1 intron_variant ; MODIFIER silent_mutation Average:50.692; most accessible tissue: Callus, score: 77.142 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1125259232 4.76E-07 3.31E-16 mr1133 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125259232 1.91E-06 NA mr1484 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125259232 8.13E-07 3.99E-07 mr1530 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125259232 3.42E-07 8.78E-10 mr1530 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125259232 3.98E-06 3.15E-07 mr1662 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125259232 3.99E-10 6.85E-13 mr1662 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125259232 NA 2.31E-08 mr1667 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125259232 4.40E-09 NA mr1745 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125259232 1.06E-07 NA mr1745 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125259232 1.56E-06 NA mr1133_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125259232 5.27E-06 5.08E-15 mr1133_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125259232 NA 4.24E-07 mr1212_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125259232 3.62E-06 NA mr1530_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125259232 7.61E-07 5.67E-11 mr1530_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125259232 4.59E-09 1.95E-12 mr1662_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125259232 NA 1.40E-10 mr1667_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251