\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1125257892:

Variant ID: vg1125257892 (JBrowse)Variation Type: INDEL
Chromosome: chr11Position: 25257892
Reference Allele: GAlternative Allele: A,GGA
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.98, A: 0.02, others allele: 0.00, population size: 107. )

Flanking Sequence (100 bp) in Reference Genome:


CCAAAACTGCCCATGGGCTACAAACGAAGGCCCAATTTGGCCTATACGATCCACACCTGAAGCAACAAGAACCAGAGGAGACGACGGTGGCGGCGGCTGG[G/A,GGA]
GAGAGAGAGGAGAGGAGAGGAGAGAGAGGGGAGGAGAGGTAGAGGAGGCGAGAGCTCGATGGCGTCGTCGCTGGGGAGGCTCAAATCCTCCATCTTTGAC

Reverse complement sequence

GTCAAAGATGGAGGATTTGAGCCTCCCCAGCGACGACGCCATCGAGCTCTCGCCTCCTCTACCTCTCCTCCCCTCTCTCTCCTCTCCTCTCCTCTCTCTC[C/T,TCC]
CCAGCCGCCGCCACCGTCGTCTCCTCTGGTTCTTGTTGCTTCAGGTGTGGATCGTATAGGCCAAATTGGGCCTTCGTTTGTAGCCCATGGGCAGTTTTGG

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 82.60% 13.80% 1.99% 1.63% GGA: 0.02%
All Indica  2759 83.40% 12.20% 3.04% 1.30% NA
All Japonica  1512 82.70% 17.10% 0.13% 0.07% NA
Aus  269 69.90% 12.30% 2.97% 14.87% NA
Indica I  595 63.40% 30.80% 4.54% 1.34% NA
Indica II  465 79.40% 20.60% 0.00% 0.00% NA
Indica III  913 94.00% 0.50% 3.40% 2.08% NA
Indica Intermediate  786 88.80% 6.70% 3.31% 1.15% NA
Temperate Japonica  767 70.70% 29.10% 0.13% 0.13% NA
Tropical Japonica  504 98.40% 1.40% 0.20% 0.00% NA
Japonica Intermediate  241 88.00% 12.00% 0.00% 0.00% NA
VI/Aromatic  96 100.00% 0.00% 0.00% 0.00% NA
Intermediate  90 75.60% 23.30% 0.00% 0.00% GGA: 1.11%

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1125257892 G -> A LOC_Os11g42000.1 5_prime_UTR_variant ; 59.0bp to feature; MODIFIER silent_mutation Average:97.176; most accessible tissue: Minghui63 young leaf, score: 98.123 N N N N
vg1125257892 G -> GGA LOC_Os11g42000.1 5_prime_UTR_variant ; 49.0bp to feature; MODIFIER silent_mutation Average:97.176; most accessible tissue: Minghui63 young leaf, score: 98.123 N N N N
vg1125257892 G -> DEL N N silent_mutation Average:97.176; most accessible tissue: Minghui63 young leaf, score: 98.123 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg1125257892 G A -0.03 -0.04 -0.02 -0.03 -0.02 -0.02
vg1125257892 G GGA 0.03 0.09 0.07 0.02 0.0 0.02

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1125257892 3.68E-06 3.25E-10 mr1191 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125257892 2.19E-16 2.05E-19 mr1191 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125257892 NA 4.35E-06 mr1295 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125257892 3.77E-14 7.93E-20 mr1530 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125257892 9.35E-07 2.74E-09 mr1530 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125257892 1.26E-07 2.21E-10 mr1530 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125257892 7.99E-07 3.26E-11 mr1644 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125257892 2.05E-18 3.76E-22 mr1644 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125257892 8.72E-08 1.29E-10 mr1662 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125257892 2.02E-11 NA mr1745 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125257892 3.81E-07 2.77E-10 mr1745 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125257892 8.23E-07 NA mr1745 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125257892 1.62E-08 4.20E-17 mr1191_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125257892 6.14E-21 4.51E-31 mr1191_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125257892 2.59E-11 4.06E-21 mr1530_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125257892 NA 3.38E-08 mr1530_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125257892 1.60E-09 2.22E-14 mr1530_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125257892 5.98E-06 9.37E-11 mr1662_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125257892 1.39E-07 NA mr1745_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125257892 NA 1.23E-12 mr1745_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251