\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1125257504:

Variant ID: vg1125257504 (JBrowse)Variation Type: SNP
Chromosome: chr11Position: 25257504
Reference Allele: TAlternative Allele: A
Primary Allele: TSecondary Allele: A

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.72, A: 0.28, others allele: 0.00, population size: 96. )

Flanking Sequence (100 bp) in Reference Genome:


GATTTTATACCTCTGAATGTATGGACGGAGAAAAAAAAAACTCTGTTTTTAGCCCCTTCTCGCTGCTTGGAGTCTGTTTTTAGCCGCCGTAGTTTCTCTA[T/A]
GCTTAAGTTTTTTTTTCTTATTTTGCTTTTTCTTCCTTCCCCTAGCATAAGCCAGTCTGGTTGATTGCGTGGTGTAACTAAAACTCTTTTTCTTCTAATA

Reverse complement sequence

TATTAGAAGAAAAAGAGTTTTAGTTACACCACGCAATCAACCAGACTGGCTTATGCTAGGGGAAGGAAGAAAAAGCAAAATAAGAAAAAAAAACTTAAGC[A/T]
TAGAGAAACTACGGCGGCTAAAAACAGACTCCAAGCAGCGAGAAGGGGCTAAAAACAGAGTTTTTTTTTTCTCCGTCCATACATTCAGAGGTATAAAATC

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 73.60% 25.70% 0.11% 0.55% NA
All Indica  2759 80.50% 19.40% 0.07% 0.04% NA
All Japonica  1512 61.80% 37.10% 0.07% 0.99% NA
Aus  269 59.50% 36.10% 0.74% 3.72% NA
Indica I  595 91.80% 8.20% 0.00% 0.00% NA
Indica II  465 48.40% 51.40% 0.22% 0.00% NA
Indica III  913 91.70% 8.30% 0.00% 0.00% NA
Indica Intermediate  786 78.00% 21.80% 0.13% 0.13% NA
Temperate Japonica  767 67.80% 32.10% 0.13% 0.00% NA
Tropical Japonica  504 48.60% 50.00% 0.00% 1.39% NA
Japonica Intermediate  241 70.50% 26.10% 0.00% 3.32% NA
VI/Aromatic  96 97.90% 2.10% 0.00% 0.00% NA
Intermediate  90 76.70% 23.30% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1125257504 T -> A LOC_Os11g41990.1 upstream_gene_variant ; 4737.0bp to feature; MODIFIER silent_mutation Average:76.779; most accessible tissue: Zhenshan97 flag leaf, score: 86.884 N N N N
vg1125257504 T -> A LOC_Os11g42000.1 upstream_gene_variant ; 380.0bp to feature; MODIFIER silent_mutation Average:76.779; most accessible tissue: Zhenshan97 flag leaf, score: 86.884 N N N N
vg1125257504 T -> A LOC_Os11g41990.2 upstream_gene_variant ; 4737.0bp to feature; MODIFIER silent_mutation Average:76.779; most accessible tissue: Zhenshan97 flag leaf, score: 86.884 N N N N
vg1125257504 T -> A LOC_Os11g41990-LOC_Os11g42000 intergenic_region ; MODIFIER silent_mutation Average:76.779; most accessible tissue: Zhenshan97 flag leaf, score: 86.884 N N N N
vg1125257504 T -> DEL N N silent_mutation Average:76.779; most accessible tissue: Zhenshan97 flag leaf, score: 86.884 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg1125257504 T A -0.01 0.0 -0.01 -0.01 -0.01 -0.01

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1125257504 NA 1.84E-08 mr1133 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125257504 1.17E-07 5.77E-11 mr1191 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125257504 3.62E-06 1.22E-07 mr1191 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125257504 1.05E-10 NA mr1238 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125257504 1.49E-08 2.67E-08 mr1238 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125257504 7.89E-06 NA mr1309 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125257504 1.78E-06 3.25E-06 mr1309 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125257504 8.54E-11 NA mr1484 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125257504 4.12E-13 6.37E-13 mr1484 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125257504 1.90E-10 2.66E-16 mr1644 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125257504 3.11E-09 3.97E-12 mr1644 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125257504 9.96E-07 NA mr1841 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125257504 1.91E-06 3.03E-06 mr1841 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125257504 1.15E-07 2.91E-07 mr1900 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125257504 5.05E-06 5.05E-06 mr1945 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125257504 3.85E-07 7.46E-14 mr1191_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125257504 NA 4.05E-10 mr1191_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125257504 3.74E-10 NA mr1238_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125257504 2.57E-07 4.09E-08 mr1238_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125257504 NA 1.95E-07 mr1380_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125257504 NA 8.20E-08 mr1380_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125257504 6.12E-11 NA mr1484_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125257504 1.44E-08 1.44E-08 mr1484_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125257504 NA 3.82E-08 mr1561_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125257504 NA 1.30E-07 mr1561_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125257504 1.86E-09 NA mr1841_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125257504 1.46E-07 7.43E-08 mr1841_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125257504 NA 2.10E-09 mr1875_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125257504 NA 1.11E-07 mr1875_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125257504 1.43E-06 NA mr1900_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125257504 3.20E-06 9.25E-07 mr1900_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125257504 NA 5.77E-07 mr1908_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125257504 NA 2.50E-06 mr1908_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125257504 4.39E-07 NA mr1945_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125257504 1.18E-07 1.18E-07 mr1945_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125257504 NA 1.60E-06 mr1951_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125257504 NA 7.96E-07 mr1996_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251