Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923).

Detailed information for vg1125256440:

Variant ID: vg1125256440 (JBrowse)Variation Type: INDEL
Chromosome: chr11Position: 25256440
Reference Allele: GAAAlternative Allele: AAA,G
Primary Allele: GAASecondary Allele: AAA

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


ATGAAGTCGTTTTGGACAGCGACACGGTCTCCAAAACACAATTTTGACTTCTTGTTTCTATAAATATATTTATTGAAAAGTGATATATATATACTTTTAT[GAA/AAA,G]
AGTATTTTTCAAGACAAATCTATTCATATAATTTTTACATTTTCAAACTCAATAACTCGAGAGTTATTCATGATTTATATTTTCAAGGTTTGACTTAAAC

Reverse complement sequence

GTTTAAGTCAAACCTTGAAAATATAAATCATGAATAACTCTCGAGTTATTGAGTTTGAAAATGTAAAAATTATATGAATAGATTTGTCTTGAAAAATACT[TTC/TTT,C]
ATAAAAGTATATATATATCACTTTTCAATAAATATATTTATAGAAACAAGAAGTCAAAATTGTGTTTTGGAGACCGTGTCGCTGTCCAAAACGACTTCAT

Allele Frequencies:

Populations Population SizeFrequency of GAA(primary allele) Frequency of AAA(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 61.50% 26.10% 6.01% 6.43% G: 0.02%
All Indica  2759 55.40% 38.90% 5.40% 0.25% G: 0.04%
All Japonica  1512 73.60% 7.00% 1.06% 18.32% NA
Aus  269 56.10% 8.90% 29.74% 5.20% NA
Indica I  595 82.40% 11.10% 6.39% 0.17% NA
Indica II  465 46.70% 51.80% 1.29% 0.00% G: 0.22%
Indica III  913 46.70% 46.30% 6.79% 0.22% NA
Indica Intermediate  786 50.30% 43.80% 5.47% 0.51% NA
Temperate Japonica  767 94.80% 2.10% 0.26% 2.87% NA
Tropical Japonica  504 39.90% 13.30% 2.38% 44.44% NA
Japonica Intermediate  241 76.80% 9.50% 0.83% 12.86% NA
VI/Aromatic  96 55.20% 7.30% 34.38% 3.12% NA
Intermediate  90 66.70% 23.30% 6.67% 3.33% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1125256440 GAA -> AAA LOC_Os11g41990.1 upstream_gene_variant ; 3673.0bp to feature; MODIFIER silent_mutation Average:85.644; most accessible tissue: Minghui63 young leaf, score: 96.279 N N N N
vg1125256440 GAA -> AAA LOC_Os11g42000.1 upstream_gene_variant ; 1444.0bp to feature; MODIFIER silent_mutation Average:85.644; most accessible tissue: Minghui63 young leaf, score: 96.279 N N N N
vg1125256440 GAA -> AAA LOC_Os11g41990.2 upstream_gene_variant ; 3673.0bp to feature; MODIFIER silent_mutation Average:85.644; most accessible tissue: Minghui63 young leaf, score: 96.279 N N N N
vg1125256440 GAA -> AAA LOC_Os11g41990-LOC_Os11g42000 intergenic_region ; MODIFIER silent_mutation Average:85.644; most accessible tissue: Minghui63 young leaf, score: 96.279 N N N N
vg1125256440 GAA -> DEL N N silent_mutation Average:85.644; most accessible tissue: Minghui63 young leaf, score: 96.279 N N N N
vg1125256440 GAA -> G LOC_Os11g41990.1 upstream_gene_variant ; 3674.0bp to feature; MODIFIER silent_mutation Average:85.644; most accessible tissue: Minghui63 young leaf, score: 96.279 N N N N
vg1125256440 GAA -> G LOC_Os11g42000.1 upstream_gene_variant ; 1443.0bp to feature; MODIFIER silent_mutation Average:85.644; most accessible tissue: Minghui63 young leaf, score: 96.279 N N N N
vg1125256440 GAA -> G LOC_Os11g41990.2 upstream_gene_variant ; 3674.0bp to feature; MODIFIER silent_mutation Average:85.644; most accessible tissue: Minghui63 young leaf, score: 96.279 N N N N
vg1125256440 GAA -> G LOC_Os11g41990-LOC_Os11g42000 intergenic_region ; MODIFIER silent_mutation Average:85.644; most accessible tissue: Minghui63 young leaf, score: 96.279 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg1125256440 GAA AAA 0.05 0.03 0.03 0.02 0.02 0.04
vg1125256440 GAA G 0.07 -0.31 -0.36 -0.01 -0.06 -0.04

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1125256440 NA 1.72E-07 mr1662 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125256440 4.65E-06 7.52E-09 mr1662 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125256440 NA 2.10E-09 mr1769 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125256440 2.01E-07 2.01E-07 mr1191_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125256440 NA 1.07E-07 mr1662_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251