\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1125256284:

Variant ID: vg1125256284 (JBrowse)Variation Type: SNP
Chromosome: chr11Position: 25256284
Reference Allele: TAlternative Allele: C
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


AAAAGGCTGATGAACACATCACACGAATTGTAGCTACCTAAACCACACGATGTCAAACTGCCAATGATGCAAAAGAATGAAGGATATGTCCCAATTAATT[T/C]
AGTGGCTGAGTGCTCCATGTAGCATACTAATTGTATACTCCCTCTGTACTCATAAATGAAGTCGTTTTGGACAGCGACACGGTCTCCAAAACACAATTTT

Reverse complement sequence

AAAATTGTGTTTTGGAGACCGTGTCGCTGTCCAAAACGACTTCATTTATGAGTACAGAGGGAGTATACAATTAGTATGCTACATGGAGCACTCAGCCACT[A/G]
AATTAATTGGGACATATCCTTCATTCTTTTGCATCATTGGCAGTTTGACATCGTGTGGTTTAGGTAGCTACAATTCGTGTGATGTGTTCATCAGCCTTTT

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 80.40% 19.10% 0.55% 0.00% NA
All Indica  2759 97.20% 2.80% 0.07% 0.00% NA
All Japonica  1512 52.20% 46.80% 0.99% 0.00% NA
Aus  269 77.70% 19.00% 3.35% 0.00% NA
Indica I  595 98.20% 1.80% 0.00% 0.00% NA
Indica II  465 98.10% 1.70% 0.22% 0.00% NA
Indica III  913 96.70% 3.30% 0.00% 0.00% NA
Indica Intermediate  786 96.40% 3.40% 0.13% 0.00% NA
Temperate Japonica  767 36.90% 63.00% 0.13% 0.00% NA
Tropical Japonica  504 80.40% 18.50% 1.19% 0.00% NA
Japonica Intermediate  241 41.90% 54.80% 3.32% 0.00% NA
VI/Aromatic  96 47.90% 52.10% 0.00% 0.00% NA
Intermediate  90 81.10% 18.90% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1125256284 T -> C LOC_Os11g41990.1 upstream_gene_variant ; 3517.0bp to feature; MODIFIER silent_mutation Average:86.972; most accessible tissue: Zhenshan97 flower, score: 97.386 N N N N
vg1125256284 T -> C LOC_Os11g42000.1 upstream_gene_variant ; 1600.0bp to feature; MODIFIER silent_mutation Average:86.972; most accessible tissue: Zhenshan97 flower, score: 97.386 N N N N
vg1125256284 T -> C LOC_Os11g41990.2 upstream_gene_variant ; 3517.0bp to feature; MODIFIER silent_mutation Average:86.972; most accessible tissue: Zhenshan97 flower, score: 97.386 N N N N
vg1125256284 T -> C LOC_Os11g41990-LOC_Os11g42000 intergenic_region ; MODIFIER silent_mutation Average:86.972; most accessible tissue: Zhenshan97 flower, score: 97.386 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg1125256284 T C -0.22 -0.02 0.03 0.02 0.04 0.07

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1125256284 3.77E-06 NA mr1300 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125256284 NA 1.01E-08 mr1364 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125256284 NA 1.06E-07 mr1443 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125256284 1.25E-06 NA mr1484 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125256284 4.15E-06 NA mr1484 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125256284 4.90E-07 NA mr1745 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125256284 6.18E-06 NA mr1926 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125256284 1.74E-06 NA mr1581_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125256284 NA 8.21E-06 mr1852_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125256284 NA 2.35E-07 mr1915_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125256284 NA 7.41E-09 mr1947_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251