\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1125245538:

Variant ID: vg1125245538 (JBrowse)Variation Type: SNP
Chromosome: chr11Position: 25245538
Reference Allele: TAlternative Allele: C
Primary Allele: TSecondary Allele: C

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.99, C: 0.01, others allele: 0.00, population size: 111. )

Flanking Sequence (100 bp) in Reference Genome:


TTACTTTTGACACCAAGACCAAGGAGAAATTAAATTACCTTGGATGCTACAAAATCAAGAAGTAAATAAAAGCATGCAACCAATGAGTATTTAGATGACT[T/C]
CTTGAGTTCTAATAAAACATTTAATTTATCTCTTCATTTAAGTCTTAAATGCATAAAAACTATAAATAGGAACAACTTATTTGGAAAAACTCAAATGTGA

Reverse complement sequence

TCACATTTGAGTTTTTCCAAATAAGTTGTTCCTATTTATAGTTTTTATGCATTTAAGACTTAAATGAAGAGATAAATTAAATGTTTTATTAGAACTCAAG[A/G]
AGTCATCTAAATACTCATTGGTTGCATGCTTTTATTTACTTCTTGATTTTGTAGCATCCAAGGTAATTTAATTTCTCCTTGGTCTTGGTGTCAAAAGTAA

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 57.80% 41.50% 0.21% 0.51% NA
All Indica  2759 40.20% 59.60% 0.14% 0.00% NA
All Japonica  1512 84.10% 14.60% 0.40% 0.86% NA
Aus  269 72.50% 23.40% 0.00% 4.09% NA
Indica I  595 37.30% 62.70% 0.00% 0.00% NA
Indica II  465 43.40% 56.10% 0.43% 0.00% NA
Indica III  913 43.40% 56.50% 0.11% 0.00% NA
Indica Intermediate  786 36.90% 63.00% 0.13% 0.00% NA
Temperate Japonica  767 97.10% 2.70% 0.13% 0.00% NA
Tropical Japonica  504 66.50% 31.70% 0.60% 1.19% NA
Japonica Intermediate  241 79.70% 16.60% 0.83% 2.90% NA
VI/Aromatic  96 97.90% 2.10% 0.00% 0.00% NA
Intermediate  90 66.70% 33.30% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1125245538 T -> DEL N N silent_mutation Average:53.258; most accessible tissue: Minghui63 panicle, score: 66.554 N N N N
vg1125245538 T -> C LOC_Os11g41990.1 downstream_gene_variant ; 244.0bp to feature; MODIFIER silent_mutation Average:53.258; most accessible tissue: Minghui63 panicle, score: 66.554 N N N N
vg1125245538 T -> C LOC_Os11g41990.2 downstream_gene_variant ; 244.0bp to feature; MODIFIER silent_mutation Average:53.258; most accessible tissue: Minghui63 panicle, score: 66.554 N N N N
vg1125245538 T -> C LOC_Os11g41970-LOC_Os11g41990 intergenic_region ; MODIFIER silent_mutation Average:53.258; most accessible tissue: Minghui63 panicle, score: 66.554 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1125245538 1.13E-13 NA mr1191 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125245538 4.34E-17 1.27E-22 mr1191 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125245538 9.47E-06 NA mr1238 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125245538 NA 7.56E-06 mr1295 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125245538 NA 1.90E-07 mr1583 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125245538 1.41E-20 2.19E-15 mr1644 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125245538 4.26E-25 5.83E-34 mr1644 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125245538 NA 1.00E-06 mr1696 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125245538 NA 1.82E-06 mr1925 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125245538 1.57E-18 NA mr1191_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125245538 2.40E-22 4.95E-34 mr1191_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125245538 5.59E-07 3.95E-06 mr1662_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125245538 NA 7.23E-06 mr1850_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251