Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1125243870:

Variant ID: vg1125243870 (JBrowse)	Variation Type: SNP
Chromosome: chr11	Position: 25243870
Reference Allele: C	Alternative Allele: T
Primary Allele: C	Secondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.96, T: 0.04, others allele: 0.00, population size: 115. )

Flanking Sequence (100 bp) in Reference Genome:

ATAATCAACTAAAAGCGCAGCATTAGAGAAGTGTGTTTATATCGTAAGTATTATAGGTTGCAATACCCTACCCGCACCACAACCAACACCCCAAAGCCAT[C/T]
GTCCACGACATCGTCGTCCTCGCCGCCGCCACCATCATCGACATGCACCACCTCGTCGTCCTCCTCTTCCTCTCTGCACTCGTTTTTGTCGTCGATGTCG

Reverse complement sequence

CGACATCGACGACAAAAACGAGTGCAGAGAGGAAGAGGAGGACGACGAGGTGGTGCATGTCGATGATGGTGGCGGCGGCGAGGACGACGATGTCGTGGAC[G/A]
ATGGCTTTGGGGTGTTGGTTGTGGTGCGGGTAGGGTATTGCAACCTATAATACTTACGATATAAACACACTTCTCTAATGCTGCGCTTTTAGTTGATTAT

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	51.80%	16.70%	0.72%	30.79%	NA
All Indica	2759	29.70%	25.90%	0.91%	43.49%	NA
All Japonica	1512	86.90%	0.50%	0.33%	12.24%	NA
Aus	269	63.90%	16.40%	1.12%	18.59%	NA
Indica I	595	7.10%	33.40%	1.85%	57.65%	NA
Indica II	465	36.60%	57.60%	0.00%	5.81%	NA
Indica III	913	36.90%	8.80%	0.77%	53.56%	NA
Indica Intermediate	786	34.40%	21.40%	0.89%	43.38%	NA
Temperate Japonica	767	96.90%	0.80%	0.00%	2.35%	NA
Tropical Japonica	504	71.80%	0.20%	0.79%	27.18%	NA
Japonica Intermediate	241	86.70%	0.40%	0.41%	12.45%	NA
VI/Aromatic	96	100.00%	0.00%	0.00%	0.00%	NA
Intermediate	90	54.40%	22.20%	1.11%	22.22%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1125243870	C -> T	LOC_Os11g41990.1	downstream_gene_variant ; 1912.0bp to feature; MODIFIER	silent_mutation	Average:11.584; most accessible tissue: Callus, score: 63.817	N	N	N	N
vg1125243870	C -> T	LOC_Os11g41990.2	downstream_gene_variant ; 1912.0bp to feature; MODIFIER	silent_mutation	Average:11.584; most accessible tissue: Callus, score: 63.817	N	N	N	N
vg1125243870	C -> T	LOC_Os11g41970-LOC_Os11g41990	intergenic_region ; MODIFIER	silent_mutation	Average:11.584; most accessible tissue: Callus, score: 63.817	N	N	N	N
vg1125243870	C -> DEL	N	N	silent_mutation	Average:11.584; most accessible tissue: Callus, score: 63.817	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1125243870	4.04E-09	6.06E-12	mr1191	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125243870	2.12E-07	9.67E-06	mr1191	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125243870	1.08E-12	1.01E-11	mr1644	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125243870	1.39E-10	3.16E-06	mr1644	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125243870	NA	7.77E-08	mr1133_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125243870	1.25E-12	2.39E-16	mr1191_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125243870	2.72E-10	2.09E-07	mr1191_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251