Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1125243705:

Variant ID: vg1125243705 (JBrowse)	Variation Type: SNP
Chromosome: chr11	Position: 25243705
Reference Allele: C	Alternative Allele: T
Primary Allele: T	Secondary Allele: C

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

TCTTTTTACATCAGAATACAAACTATATTAATGATAAGCTTTGTTTTCTAAAAGTCAAAATATGCCCTATATCTTTGAACAGAAGGAGTACCTCCCTTTA[C/T]
AATATTTGCACAAGTACTGCCTATTTATGAAATTTGACCACTCATCTTCTTTATAAAATATTTTATAATCAACTAAAAGCGCAGCATTAGAGAAGTGTGT

Reverse complement sequence

ACACACTTCTCTAATGCTGCGCTTTTAGTTGATTATAAAATATTTTATAAAGAAGATGAGTGGTCAAATTTCATAAATAGGCAGTACTTGTGCAAATATT[G/A]
TAAAGGGAGGTACTCCTTCTGTTCAAAGATATAGGGCATATTTTGACTTTTAGAAAACAAAGCTTATCATTAATATAGTTTGTATTCTGATGTAAAAAGA

Allele Frequencies:

Populations	Population Size	Frequency of T(primary allele)	Frequency of C(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	41.50%	26.50%	0.61%	31.38%	NA
All Indica	2759	50.90%	4.00%	0.94%	44.15%	NA
All Japonica	1512	23.10%	64.10%	0.13%	12.70%	NA
Aus	269	46.10%	34.20%	0.37%	19.33%	NA
Indica I	595	36.50%	2.90%	1.68%	58.99%	NA
Indica II	465	90.50%	3.20%	0.43%	5.81%	NA
Indica III	913	40.50%	4.70%	0.77%	54.00%	NA
Indica Intermediate	786	50.40%	4.60%	0.89%	44.15%	NA
Temperate Japonica	767	5.60%	91.90%	0.13%	2.35%	NA
Tropical Japonica	504	51.20%	20.20%	0.00%	28.57%	NA
Japonica Intermediate	241	19.90%	67.20%	0.41%	12.45%	NA
VI/Aromatic	96	47.90%	52.10%	0.00%	0.00%	NA
Intermediate	90	44.40%	32.20%	0.00%	23.33%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1125243705	C -> T	LOC_Os11g41990.1	downstream_gene_variant ; 2077.0bp to feature; MODIFIER	silent_mutation	Average:13.093; most accessible tissue: Callus, score: 82.683	N	N	N	N
vg1125243705	C -> T	LOC_Os11g41990.2	downstream_gene_variant ; 2077.0bp to feature; MODIFIER	silent_mutation	Average:13.093; most accessible tissue: Callus, score: 82.683	N	N	N	N
vg1125243705	C -> T	LOC_Os11g41970-LOC_Os11g41990	intergenic_region ; MODIFIER	silent_mutation	Average:13.093; most accessible tissue: Callus, score: 82.683	N	N	N	N
vg1125243705	C -> DEL	N	N	silent_mutation	Average:13.093; most accessible tissue: Callus, score: 82.683	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1125243705	7.78E-13	6.88E-19	mr1191	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125243705	2.54E-10	1.31E-08	mr1191	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125243705	4.68E-16	2.92E-21	mr1644	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125243705	1.93E-12	1.40E-08	mr1644	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125243705	1.25E-09	8.37E-09	mr1662	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125243705	3.65E-07	8.04E-09	mr1662	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125243705	NA	5.15E-07	mr1723	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125243705	1.10E-16	6.86E-26	mr1191_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125243705	3.69E-11	6.38E-10	mr1191_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125243705	8.79E-09	1.38E-12	mr1662_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125243705	NA	1.66E-07	mr1662_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125243705	NA	7.91E-08	mr1933_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251