\
| Variant ID: vg1125240423 (JBrowse) | Variation Type: SNP |
| Chromosome: chr11 | Position: 25240423 |
| Reference Allele: T | Alternative Allele: A |
| Primary Allele: T | Secondary Allele: A |
Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.98, A: 0.02, others allele: 0.00, population size: 200. )
GAATTAGCAATGCATCAGGTGCCACAAATTCAGGAACAGCCTTAAACAATGTGGCCAAGCAGAAAAACTTGATAGCAATGAAGTCGTATTAAGTGAGAGC[T/A]
ACAAAAATCTCCCAGTTTTTTTGGCTACTGATGTGATAAATGAATCTTGTGTTGCATGTACTTATGTGAAGTTGTATGTTGATCTAGTTGGGAAGCGCAT
ATGCGCTTCCCAACTAGATCAACATACAACTTCACATAAGTACATGCAACACAAGATTCATTTATCACATCAGTAGCCAAAAAAACTGGGAGATTTTTGT[A/T]
GCTCTCACTTAATACGACTTCATTGCTATCAAGTTTTTCTGCTTGGCCACATTGTTTAAGGCTGTTCCTGAATTTGTGGCACCTGATGCATTGCTAATTC
| Populations | Population Size | Frequency of T(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 61.60% | 7.50% | 1.25% | 29.69% | NA |
| All Indica | 2759 | 55.70% | 0.70% | 1.81% | 41.86% | NA |
| All Japonica | 1512 | 69.20% | 18.20% | 0.53% | 12.10% | NA |
| Aus | 269 | 63.90% | 19.00% | 0.37% | 16.73% | NA |
| Indica I | 595 | 42.00% | 0.30% | 3.53% | 54.12% | NA |
| Indica II | 465 | 93.50% | 0.60% | 0.00% | 5.81% | NA |
| Indica III | 913 | 45.00% | 1.00% | 1.42% | 52.57% | NA |
| Indica Intermediate | 786 | 56.00% | 0.50% | 2.04% | 41.48% | NA |
| Temperate Japonica | 767 | 68.60% | 28.80% | 0.39% | 2.22% | NA |
| Tropical Japonica | 504 | 69.00% | 3.20% | 0.79% | 26.98% | NA |
| Japonica Intermediate | 241 | 71.40% | 15.80% | 0.41% | 12.45% | NA |
| VI/Aromatic | 96 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 67.80% | 10.00% | 0.00% | 22.22% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1125240423 | T -> A | LOC_Os11g41970-LOC_Os11g41990 | intergenic_region ; MODIFIER | silent_mutation | Average:11.164; most accessible tissue: Callus, score: 65.783 | N | N | N | N |
| vg1125240423 | T -> DEL | N | N | silent_mutation | Average:11.164; most accessible tissue: Callus, score: 65.783 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1125240423 | NA | 8.99E-07 | mr1229 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1125240423 | 1.51E-08 | NA | mr1484 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1125240423 | 5.66E-07 | NA | mr1484 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1125240423 | 3.72E-10 | 3.81E-10 | mr1530 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1125240423 | 6.25E-08 | 8.98E-11 | mr1530 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1125240423 | 4.43E-13 | NA | mr1745 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1125240423 | 1.95E-07 | NA | mr1745 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1125240423 | 1.05E-07 | NA | mr1530_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1125240423 | 5.36E-08 | 9.11E-13 | mr1530_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1125240423 | 5.06E-07 | NA | mr1745_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |