\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1125240423:

Variant ID: vg1125240423 (JBrowse)Variation Type: SNP
Chromosome: chr11Position: 25240423
Reference Allele: TAlternative Allele: A
Primary Allele: TSecondary Allele: A

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.98, A: 0.02, others allele: 0.00, population size: 200. )

Flanking Sequence (100 bp) in Reference Genome:


GAATTAGCAATGCATCAGGTGCCACAAATTCAGGAACAGCCTTAAACAATGTGGCCAAGCAGAAAAACTTGATAGCAATGAAGTCGTATTAAGTGAGAGC[T/A]
ACAAAAATCTCCCAGTTTTTTTGGCTACTGATGTGATAAATGAATCTTGTGTTGCATGTACTTATGTGAAGTTGTATGTTGATCTAGTTGGGAAGCGCAT

Reverse complement sequence

ATGCGCTTCCCAACTAGATCAACATACAACTTCACATAAGTACATGCAACACAAGATTCATTTATCACATCAGTAGCCAAAAAAACTGGGAGATTTTTGT[A/T]
GCTCTCACTTAATACGACTTCATTGCTATCAAGTTTTTCTGCTTGGCCACATTGTTTAAGGCTGTTCCTGAATTTGTGGCACCTGATGCATTGCTAATTC

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 61.60% 7.50% 1.25% 29.69% NA
All Indica  2759 55.70% 0.70% 1.81% 41.86% NA
All Japonica  1512 69.20% 18.20% 0.53% 12.10% NA
Aus  269 63.90% 19.00% 0.37% 16.73% NA
Indica I  595 42.00% 0.30% 3.53% 54.12% NA
Indica II  465 93.50% 0.60% 0.00% 5.81% NA
Indica III  913 45.00% 1.00% 1.42% 52.57% NA
Indica Intermediate  786 56.00% 0.50% 2.04% 41.48% NA
Temperate Japonica  767 68.60% 28.80% 0.39% 2.22% NA
Tropical Japonica  504 69.00% 3.20% 0.79% 26.98% NA
Japonica Intermediate  241 71.40% 15.80% 0.41% 12.45% NA
VI/Aromatic  96 100.00% 0.00% 0.00% 0.00% NA
Intermediate  90 67.80% 10.00% 0.00% 22.22% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1125240423 T -> A LOC_Os11g41970-LOC_Os11g41990 intergenic_region ; MODIFIER silent_mutation Average:11.164; most accessible tissue: Callus, score: 65.783 N N N N
vg1125240423 T -> DEL N N silent_mutation Average:11.164; most accessible tissue: Callus, score: 65.783 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1125240423 NA 8.99E-07 mr1229 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125240423 1.51E-08 NA mr1484 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125240423 5.66E-07 NA mr1484 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125240423 3.72E-10 3.81E-10 mr1530 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125240423 6.25E-08 8.98E-11 mr1530 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125240423 4.43E-13 NA mr1745 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125240423 1.95E-07 NA mr1745 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125240423 1.05E-07 NA mr1530_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125240423 5.36E-08 9.11E-13 mr1530_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125240423 5.06E-07 NA mr1745_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251