\
| Variant ID: vg1125238334 (JBrowse) | Variation Type: SNP |
| Chromosome: chr11 | Position: 25238334 |
| Reference Allele: G | Alternative Allele: A |
| Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.85, A: 0.14, others allele: 0.00, population size: 107. )
TCCCTGTACAATCCTCTGCTTTCAAATTCCTCCTGACCCCATTGCTTCGCCTTCATGGTCTCCAGCAGCAGCTGCTTGGTACACGCCGAGATGGGGATGG[G/A]
CAGGCCCGAGTAAGCCAACCTGTTCCACCAGTCCTCGACTCCCATCCACCTCGCAATCTTGCTGCATCGGCTGGCCCTGCTGTGCACGCACAACTGAATC
GATTCAGTTGTGCGTGCACAGCAGGGCCAGCCGATGCAGCAAGATTGCGAGGTGGATGGGAGTCGAGGACTGGTGGAACAGGTTGGCTTACTCGGGCCTG[C/T]
CCATCCCCATCTCGGCGTGTACCAAGCAGCTGCTGCTGGAGACCATGAAGGCGAAGCAATGGGGTCAGGAGGAATTTGAAAGCAGAGGATTGTACAGGGA
| Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 42.90% | 25.40% | 0.97% | 30.66% | NA |
| All Indica | 2759 | 27.70% | 27.90% | 1.38% | 42.99% | NA |
| All Japonica | 1512 | 66.00% | 21.20% | 0.13% | 12.70% | NA |
| Aus | 269 | 45.70% | 34.20% | 1.49% | 18.59% | NA |
| Indica I | 595 | 38.20% | 2.70% | 1.85% | 57.31% | NA |
| Indica II | 465 | 59.80% | 34.00% | 0.86% | 5.38% | NA |
| Indica III | 913 | 7.30% | 38.70% | 1.20% | 52.79% | NA |
| Indica Intermediate | 786 | 24.40% | 31.00% | 1.53% | 43.00% | NA |
| Temperate Japonica | 767 | 94.00% | 3.40% | 0.26% | 2.35% | NA |
| Tropical Japonica | 504 | 20.40% | 51.00% | 0.00% | 28.57% | NA |
| Japonica Intermediate | 241 | 72.20% | 15.40% | 0.00% | 12.45% | NA |
| VI/Aromatic | 96 | 96.90% | 2.10% | 1.04% | 0.00% | NA |
| Intermediate | 90 | 56.70% | 18.90% | 1.11% | 23.33% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1125238334 | G -> A | LOC_Os11g41970.1 | upstream_gene_variant ; 3143.0bp to feature; MODIFIER | silent_mutation | Average:12.349; most accessible tissue: Callus, score: 64.526 | N | N | N | N |
| vg1125238334 | G -> A | LOC_Os11g41970-LOC_Os11g41990 | intergenic_region ; MODIFIER | silent_mutation | Average:12.349; most accessible tissue: Callus, score: 64.526 | N | N | N | N |
| vg1125238334 | G -> DEL | N | N | silent_mutation | Average:12.349; most accessible tissue: Callus, score: 64.526 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1125238334 | 9.34E-08 | NA | mr1238 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1125238334 | 5.03E-06 | 1.99E-06 | mr1238 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1125238334 | 3.30E-06 | NA | mr1309 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1125238334 | NA | 2.85E-06 | mr1309 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1125238334 | 1.45E-09 | NA | mr1484 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1125238334 | 2.58E-06 | NA | mr1484 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1125238334 | 7.34E-06 | 1.44E-07 | mr1662 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1125238334 | NA | 2.61E-08 | mr1723 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1125238334 | 1.59E-06 | NA | mr1841 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1125238334 | 1.15E-06 | NA | mr1925 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1125238334 | 3.85E-06 | NA | mr1238_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1125238334 | NA | 1.97E-06 | mr1609_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1125238334 | NA | 1.02E-06 | mr1723_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1125238334 | 2.58E-06 | NA | mr1841_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1125238334 | 4.69E-06 | NA | mr1900_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1125238334 | NA | 1.65E-06 | mr1900_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |