Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1125232324:

Variant ID: vg1125232324 (JBrowse)	Variation Type: SNP
Chromosome: chr11	Position: 25232324
Reference Allele: T	Alternative Allele: C
Primary Allele: T	Secondary Allele: C

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.88, C: 0.12, others allele: 0.00, population size: 97. )

Flanking Sequence (100 bp) in Reference Genome:

AGGCGAAGCGGATTTTGGCGGCGGCGCTACTAACCTCCGACGACGAAGATAGCAAGCCTCCGACGACGATGGAGAAGAGGAAGACGAAGATGGTGCGCTT[T/C]
ACCCAACAGCAGATCAAGAACTGCATGGCGTTCAGTGCGGACATATCCGACGACGACGACGAGGAATCCCTGCCCAAGCTCTCGGAGGTGCTCAGCAAGG

Reverse complement sequence

CCTTGCTGAGCACCTCCGAGAGCTTGGGCAGGGATTCCTCGTCGTCGTCGTCGGATATGTCCGCACTGAACGCCATGCAGTTCTTGATCTGCTGTTGGGT[A/G]
AAGCGCACCATCTTCGTCTTCCTCTTCTCCATCGTCGTCGGAGGCTTGCTATCTTCGTCGTCGGAGGTTAGTAGCGCCGCCGCCAAAATCCGCTTCGCCT

Allele Frequencies:

Populations	Population Size	Frequency of T(primary allele)	Frequency of C(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	66.60%	33.30%	0.04%	0.00%	NA
All Indica	2759	54.50%	45.40%	0.07%	0.00%	NA
All Japonica	1512	86.10%	13.90%	0.00%	0.00%	NA
Aus	269	66.50%	33.50%	0.00%	0.00%	NA
Indica I	595	39.50%	60.50%	0.00%	0.00%	NA
Indica II	465	93.30%	6.50%	0.22%	0.00%	NA
Indica III	913	44.70%	55.30%	0.00%	0.00%	NA
Indica Intermediate	786	54.50%	45.40%	0.13%	0.00%	NA
Temperate Japonica	767	97.50%	2.50%	0.00%	0.00%	NA
Tropical Japonica	504	69.20%	30.80%	0.00%	0.00%	NA
Japonica Intermediate	241	85.10%	14.90%	0.00%	0.00%	NA
VI/Aromatic	96	100.00%	0.00%	0.00%	0.00%	NA
Intermediate	90	74.40%	25.60%	0.00%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1125232324	T -> C	LOC_Os11g41960.1	synonymous_variant ; p.Phe11Phe; LOW	synonymous_codon	Average:62.995; most accessible tissue: Callus, score: 88.017	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1125232324	2.35E-14	NA	mr1191	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125232324	3.03E-12	2.23E-09	mr1191	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125232324	NA	2.88E-06	mr1367	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125232324	5.61E-14	NA	mr1644	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125232324	7.58E-14	1.04E-09	mr1644	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125232324	2.55E-08	NA	mr1662	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125232324	NA	5.95E-08	mr1696	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125232324	NA	7.78E-06	mr1794	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125232324	NA	2.35E-06	mr1918	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125232324	NA	2.66E-06	mr1094_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125232324	NA	1.54E-06	mr1159_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125232324	4.98E-15	NA	mr1191_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125232324	4.24E-14	1.38E-09	mr1191_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125232324	6.91E-08	NA	mr1662_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125232324	3.84E-06	3.25E-06	mr1662_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125232324	NA	1.47E-08	mr1861_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125232324	NA	2.87E-06	mr1895_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125232324	NA	3.57E-09	mr1933_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125232324	NA	4.71E-06	mr1942_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251