\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1125230830:

Variant ID: vg1125230830 (JBrowse)Variation Type: SNP
Chromosome: chr11Position: 25230830
Reference Allele: CAlternative Allele: G
Primary Allele: CSecondary Allele: G

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.98, G: 0.02, others allele: 0.00, population size: 96. )

Flanking Sequence (100 bp) in Reference Genome:


ACCATCTTCGTCTTCGCCTTCTTCTTCTTCTTCTTCTTCTCCATCACCGGCGCCTTGCCTTCATCGGAGGTAACCGGCGCCGGCGCCGGAATTTGTCCGT[C/G]
ACTTTTTTTCCCCGAGGGAGCTTCATCGGAAGGATCCATCGTTGTCGATGGAATTTGGCTTTGATCACATGTTCCCTTGGATGTGCTCGCCATTGTATTT

Reverse complement sequence

AAATACAATGGCGAGCACATCCAAGGGAACATGTGATCAAAGCCAAATTCCATCGACAACGATGGATCCTTCCGATGAAGCTCCCTCGGGGAAAAAAAGT[G/C]
ACGGACAAATTCCGGCGCCGGCGCCGGTTACCTCCGATGAAGGCAAGGCGCCGGTGATGGAGAAGAAGAAGAAGAAGAAGAAGGCGAAGACGAAGATGGT

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 65.80% 34.10% 0.06% 0.00% NA
All Indica  2759 58.50% 41.40% 0.11% 0.00% NA
All Japonica  1512 79.50% 20.50% 0.00% 0.00% NA
Aus  269 55.40% 44.60% 0.00% 0.00% NA
Indica I  595 65.00% 35.00% 0.00% 0.00% NA
Indica II  465 45.40% 54.20% 0.43% 0.00% NA
Indica III  913 58.70% 41.20% 0.11% 0.00% NA
Indica Intermediate  786 61.20% 38.80% 0.00% 0.00% NA
Temperate Japonica  767 96.00% 4.00% 0.00% 0.00% NA
Tropical Japonica  504 51.60% 48.40% 0.00% 0.00% NA
Japonica Intermediate  241 85.50% 14.50% 0.00% 0.00% NA
VI/Aromatic  96 90.60% 9.40% 0.00% 0.00% NA
Intermediate  90 65.60% 34.40% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1125230830 C -> G LOC_Os11g41950.1 missense_variant ; p.Asp32His; MODERATE nonsynonymous_codon ; D32H Average:48.656; most accessible tissue: Zhenshan97 flower, score: 68.734 unknown unknown TOLERATED 0.12

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1125230830 1.27E-13 7.76E-22 mr1191 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125230830 4.81E-18 4.24E-22 mr1191 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125230830 NA 6.21E-06 mr1238 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125230830 NA 2.89E-06 mr1380 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125230830 NA 5.17E-08 mr1561 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125230830 NA 5.28E-06 mr1561 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125230830 7.34E-16 7.84E-26 mr1644 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125230830 2.83E-19 1.97E-24 mr1644 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125230830 1.13E-08 1.40E-07 mr1662 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125230830 NA 1.54E-06 mr1662 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125230830 NA 1.79E-07 mr1723 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125230830 NA 8.61E-06 mr1900 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125230830 NA 2.78E-06 mr1908 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125230830 NA 6.06E-06 mr1937 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125230830 2.76E-14 2.43E-30 mr1191_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125230830 4.91E-19 2.96E-28 mr1191_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125230830 1.34E-07 3.47E-09 mr1662_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125230830 NA 9.45E-06 mr1662_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251