Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1125229010:

Variant ID: vg1125229010 (JBrowse)	Variation Type: SNP
Chromosome: chr11	Position: 25229010
Reference Allele: G	Alternative Allele: A
Primary Allele: G	Secondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

ACCTGGATACAAGAACTTCTCCGAGGAATTACTTGCATGTTTCCTCGTCGATCGGCTGGATGACTACTTCGCTAGAAAGAACAAGATACATGACAAGCGC[G/A]
TGAAACCAATCCTGGAGTTGGTAAAAAAAACCAATCCTGGAGTTGGTAAAAAAAACCAATCCTGGAGTTGGTAAAAAAAACCAATCCTGGAGGAGCAGAG

Reverse complement sequence

CTCTGCTCCTCCAGGATTGGTTTTTTTTACCAACTCCAGGATTGGTTTTTTTTACCAACTCCAGGATTGGTTTTTTTTACCAACTCCAGGATTGGTTTCA[C/T]
GCGCTTGTCATGTATCTTGTTCTTTCTAGCGAAGTAGTCATCCAGCCGATCGACGAGGAAACATGCAAGTAATTCCTCGGAGAAGTTCTTGTATCCAGGT

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	94.60%	2.80%	1.48%	1.12%	NA
All Indica	2759	99.90%	0.00%	0.00%	0.07%	NA
All Japonica	1512	83.90%	8.30%	4.50%	3.24%	NA
Aus	269	100.00%	0.00%	0.00%	0.00%	NA
Indica I	595	100.00%	0.00%	0.00%	0.00%	NA
Indica II	465	99.60%	0.00%	0.00%	0.43%	NA
Indica III	913	100.00%	0.00%	0.00%	0.00%	NA
Indica Intermediate	786	100.00%	0.00%	0.00%	0.00%	NA
Temperate Japonica	767	73.00%	13.70%	8.21%	5.08%	NA
Tropical Japonica	504	98.20%	1.40%	0.20%	0.20%	NA
Japonica Intermediate	241	88.80%	5.80%	1.66%	3.73%	NA
VI/Aromatic	96	100.00%	0.00%	0.00%	0.00%	NA
Intermediate	90	91.10%	4.40%	2.22%	2.22%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1125229010	G -> A	LOC_Os11g41960.1	upstream_gene_variant ; 3282.0bp to feature; MODIFIER	silent_mutation	Average:51.968; most accessible tissue: Callus, score: 77.93	N	N	N	N
vg1125229010	G -> A	LOC_Os11g41940.1	downstream_gene_variant ; 1684.0bp to feature; MODIFIER	silent_mutation	Average:51.968; most accessible tissue: Callus, score: 77.93	N	N	N	N
vg1125229010	G -> A	LOC_Os11g41950.1	downstream_gene_variant ; 1359.0bp to feature; MODIFIER	silent_mutation	Average:51.968; most accessible tissue: Callus, score: 77.93	N	N	N	N
vg1125229010	G -> A	LOC_Os11g41940-LOC_Os11g41950	intergenic_region ; MODIFIER	silent_mutation	Average:51.968; most accessible tissue: Callus, score: 77.93	N	N	N	N
vg1125229010	G -> DEL	N	N	silent_mutation	Average:51.968; most accessible tissue: Callus, score: 77.93	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1125229010	2.72E-07	NA	mr1238	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125229010	2.90E-07	NA	mr1309	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125229010	4.54E-10	NA	mr1484	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125229010	4.85E-07	NA	mr1484	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125229010	1.20E-06	9.97E-10	mr1530	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125229010	NA	1.08E-06	mr1530	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125229010	NA	7.84E-06	mr1826	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125229010	1.02E-06	NA	mr1841	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125229010	6.56E-06	NA	mr1900	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125229010	5.70E-09	NA	mr1238_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125229010	3.08E-11	NA	mr1484_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125229010	1.44E-08	NA	mr1530_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125229010	NA	1.30E-11	mr1530_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125229010	7.28E-09	NA	mr1841_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125229010	2.89E-08	NA	mr1900_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125229010	6.34E-10	NA	mr1945_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251