Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1125225153:

Variant ID: vg1125225153 (JBrowse)	Variation Type: SNP
Chromosome: chr11	Position: 25225153
Reference Allele: A	Alternative Allele: G
Primary Allele: A	Secondary Allele: G

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.67, G: 0.33, others allele: 0.00, population size: 101. )

Flanking Sequence (100 bp) in Reference Genome:

CGCCTCGCTGTCGACGGGTACGTCGCCTACCACTGAAAGCACAACGCCTCTTTGAAGACTGGGCCGGCAAATCCTGGAGAGATTAACAAAGTCACCACAG[A/G]
CGCCTCGCTGTCGACGGGTACGTCGCCTACCACTGAAAGCACAACGCCGATATATATATCCTAGAAAATTCACTCCCATGGTGAGTCGAAACCAGGACCT

Reverse complement sequence

AGGTCCTGGTTTCGACTCACCATGGGAGTGAATTTTCTAGGATATATATATCGGCGTTGTGCTTTCAGTGGTAGGCGACGTACCCGTCGACAGCGAGGCG[T/C]
CTGTGGTGACTTTGTTAATCTCTCCAGGATTTGCCGGCCCAGTCTTCAAAGAGGCGTTGTGCTTTCAGTGGTAGGCGACGTACCCGTCGACAGCGAGGCG

Allele Frequencies:

Populations	Population Size	Frequency of A(primary allele)	Frequency of G(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	33.90%	33.00%	11.55%	21.52%	NA
All Indica	2759	4.80%	49.30%	13.16%	32.69%	NA
All Japonica	1512	84.60%	2.50%	9.26%	3.64%	NA
Aus	269	30.10%	41.30%	10.04%	18.59%	NA
Indica I	595	2.70%	36.30%	3.53%	57.48%	NA
Indica II	465	3.00%	90.10%	4.09%	2.80%	NA
Indica III	913	6.50%	37.90%	23.55%	32.09%	NA
Indica Intermediate	786	5.60%	48.30%	13.74%	32.32%	NA
Temperate Japonica	767	96.50%	1.00%	0.91%	1.56%	NA
Tropical Japonica	504	67.90%	3.40%	22.42%	6.35%	NA
Japonica Intermediate	241	81.70%	5.40%	8.30%	4.56%	NA
VI/Aromatic	96	79.20%	20.80%	0.00%	0.00%	NA
Intermediate	90	38.90%	32.20%	17.78%	11.11%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1125225153	A -> DEL	N	N	silent_mutation	Average:27.719; most accessible tissue: Zhenshan97 flower, score: 47.586	N	N	N	N
vg1125225153	A -> G	LOC_Os11g41940.1	upstream_gene_variant ; 515.0bp to feature; MODIFIER	silent_mutation	Average:27.719; most accessible tissue: Zhenshan97 flower, score: 47.586	N	N	N	N
vg1125225153	A -> G	LOC_Os11g41920.1	downstream_gene_variant ; 2796.0bp to feature; MODIFIER	silent_mutation	Average:27.719; most accessible tissue: Zhenshan97 flower, score: 47.586	N	N	N	N
vg1125225153	A -> G	LOC_Os11g41920-LOC_Os11g41940	intergenic_region ; MODIFIER	silent_mutation	Average:27.719; most accessible tissue: Zhenshan97 flower, score: 47.586	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1125225153	NA	4.01E-15	mr1583	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125225153	NA	3.56E-08	mr1583	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125225153	NA	9.19E-08	mr1659	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125225153	2.58E-06	NA	mr1895	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125225153	NA	1.53E-13	mr1191_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251