\
| Variant ID: vg1125225153 (JBrowse) | Variation Type: SNP |
| Chromosome: chr11 | Position: 25225153 |
| Reference Allele: A | Alternative Allele: G |
| Primary Allele: A | Secondary Allele: G |
Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.67, G: 0.33, others allele: 0.00, population size: 101. )
CGCCTCGCTGTCGACGGGTACGTCGCCTACCACTGAAAGCACAACGCCTCTTTGAAGACTGGGCCGGCAAATCCTGGAGAGATTAACAAAGTCACCACAG[A/G]
CGCCTCGCTGTCGACGGGTACGTCGCCTACCACTGAAAGCACAACGCCGATATATATATCCTAGAAAATTCACTCCCATGGTGAGTCGAAACCAGGACCT
AGGTCCTGGTTTCGACTCACCATGGGAGTGAATTTTCTAGGATATATATATCGGCGTTGTGCTTTCAGTGGTAGGCGACGTACCCGTCGACAGCGAGGCG[T/C]
CTGTGGTGACTTTGTTAATCTCTCCAGGATTTGCCGGCCCAGTCTTCAAAGAGGCGTTGTGCTTTCAGTGGTAGGCGACGTACCCGTCGACAGCGAGGCG
| Populations | Population Size | Frequency of A(primary allele) | Frequency of G(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 33.90% | 33.00% | 11.55% | 21.52% | NA |
| All Indica | 2759 | 4.80% | 49.30% | 13.16% | 32.69% | NA |
| All Japonica | 1512 | 84.60% | 2.50% | 9.26% | 3.64% | NA |
| Aus | 269 | 30.10% | 41.30% | 10.04% | 18.59% | NA |
| Indica I | 595 | 2.70% | 36.30% | 3.53% | 57.48% | NA |
| Indica II | 465 | 3.00% | 90.10% | 4.09% | 2.80% | NA |
| Indica III | 913 | 6.50% | 37.90% | 23.55% | 32.09% | NA |
| Indica Intermediate | 786 | 5.60% | 48.30% | 13.74% | 32.32% | NA |
| Temperate Japonica | 767 | 96.50% | 1.00% | 0.91% | 1.56% | NA |
| Tropical Japonica | 504 | 67.90% | 3.40% | 22.42% | 6.35% | NA |
| Japonica Intermediate | 241 | 81.70% | 5.40% | 8.30% | 4.56% | NA |
| VI/Aromatic | 96 | 79.20% | 20.80% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 38.90% | 32.20% | 17.78% | 11.11% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1125225153 | A -> DEL | N | N | silent_mutation | Average:27.719; most accessible tissue: Zhenshan97 flower, score: 47.586 | N | N | N | N |
| vg1125225153 | A -> G | LOC_Os11g41940.1 | upstream_gene_variant ; 515.0bp to feature; MODIFIER | silent_mutation | Average:27.719; most accessible tissue: Zhenshan97 flower, score: 47.586 | N | N | N | N |
| vg1125225153 | A -> G | LOC_Os11g41920.1 | downstream_gene_variant ; 2796.0bp to feature; MODIFIER | silent_mutation | Average:27.719; most accessible tissue: Zhenshan97 flower, score: 47.586 | N | N | N | N |
| vg1125225153 | A -> G | LOC_Os11g41920-LOC_Os11g41940 | intergenic_region ; MODIFIER | silent_mutation | Average:27.719; most accessible tissue: Zhenshan97 flower, score: 47.586 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1125225153 | NA | 4.01E-15 | mr1583 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1125225153 | NA | 3.56E-08 | mr1583 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1125225153 | NA | 9.19E-08 | mr1659 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1125225153 | 2.58E-06 | NA | mr1895 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1125225153 | NA | 1.53E-13 | mr1191_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |