\
| Variant ID: vg1125216297 (JBrowse) | Variation Type: SNP |
| Chromosome: chr11 | Position: 25216297 |
| Reference Allele: A | Alternative Allele: G |
| Primary Allele: A | Secondary Allele: G |
Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 1.00, G: 0.00, others allele: 0.00, population size: 272. )
ATGTGATGATAGAACATATAGAAAAACTATTTAATTGATCTGGGTATATCCAACACCGCTATGAATTTCATATTAGGAGTAATGTTTTGTGCTCTACCAT[A/G]
CCTGCTGTTATAAGTCATATGATGATGAGGTTAAATAGAATTGTCATACTAATTACTCCATCTGTTCTTGGCAGGTAAATCTGCAGACAACAGCTTGCAG
CTGCAAGCTGTTGTCTGCAGATTTACCTGCCAAGAACAGATGGAGTAATTAGTATGACAATTCTATTTAACCTCATCATCATATGACTTATAACAGCAGG[T/C]
ATGGTAGAGCACAAAACATTACTCCTAATATGAAATTCATAGCGGTGTTGGATATACCCAGATCAATTAAATAGTTTTTCTATATGTTCTATCATCACAT
| Populations | Population Size | Frequency of A(primary allele) | Frequency of G(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 74.20% | 25.70% | 0.11% | 0.00% | NA |
| All Indica | 2759 | 61.90% | 38.00% | 0.11% | 0.00% | NA |
| All Japonica | 1512 | 93.20% | 6.70% | 0.13% | 0.00% | NA |
| Aus | 269 | 82.90% | 17.10% | 0.00% | 0.00% | NA |
| Indica I | 595 | 70.30% | 29.60% | 0.17% | 0.00% | NA |
| Indica II | 465 | 61.90% | 38.10% | 0.00% | 0.00% | NA |
| Indica III | 913 | 60.60% | 39.40% | 0.00% | 0.00% | NA |
| Indica Intermediate | 786 | 57.00% | 42.70% | 0.25% | 0.00% | NA |
| Temperate Japonica | 767 | 97.50% | 2.20% | 0.26% | 0.00% | NA |
| Tropical Japonica | 504 | 87.30% | 12.70% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 91.70% | 8.30% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 96.90% | 3.10% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 81.10% | 18.90% | 0.00% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1125216297 | A -> G | LOC_Os11g41920.1 | upstream_gene_variant ; 2030.0bp to feature; MODIFIER | silent_mutation | Average:62.817; most accessible tissue: Callus, score: 89.558 | N | N | N | N |
| vg1125216297 | A -> G | LOC_Os11g41910.1 | intron_variant ; MODIFIER | silent_mutation | Average:62.817; most accessible tissue: Callus, score: 89.558 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1125216297 | 2.74E-08 | NA | mr1191 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1125216297 | 1.82E-08 | 1.43E-12 | mr1191 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1125216297 | 1.08E-07 | NA | mr1644 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1125216297 | 7.18E-08 | 4.89E-13 | mr1644 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1125216297 | 2.82E-08 | NA | mr1191_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1125216297 | 4.59E-09 | 1.15E-16 | mr1191_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1125216297 | NA | 1.11E-07 | mr1498_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1125216297 | 2.59E-06 | NA | mr1662_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1125216297 | NA | 5.28E-07 | mr1925_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |