Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1125214331:

Variant ID: vg1125214331 (JBrowse)	Variation Type: SNP
Chromosome: chr11	Position: 25214331
Reference Allele: G	Alternative Allele: A
Primary Allele: A	Secondary Allele: G

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.65, G: 0.35, others allele: 0.00, population size: 268. )

Flanking Sequence (100 bp) in Reference Genome:

GAAAGAAATTTACATCTCATAGGAAAGTAATTCTAATTTGCTGATATTGCAATATGCTGCAGAAGTACAAACTCATTGACACCGCTGGCATCCGACGAAG[G/A]
GCAGCAGTTGCTTCTGCTGGCAGCACAACGGAAACACTTTCAGTAAAACGTGCATTTCGTGCAATCCGCCGGTCTGATGTGGTTGCCCTTGTTGTTGAAG

Reverse complement sequence

CTTCAACAACAAGGGCAACCACATCAGACCGGCGGATTGCACGAAATGCACGTTTTACTGAAAGTGTTTCCGTTGTGCTGCCAGCAGAAGCAACTGCTGC[C/T]
CTTCGTCGGATGCCAGCGGTGTCAATGAGTTTGTACTTCTGCAGCATATTGCAATATCAGCAAATTAGAATTACTTTCCTATGAGATGTAAATTTCTTTC

Allele Frequencies:

Populations	Population Size	Frequency of A(primary allele)	Frequency of G(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	53.20%	46.60%	0.17%	0.02%	NA
All Indica	2759	67.60%	32.20%	0.14%	0.04%	NA
All Japonica	1512	33.10%	66.70%	0.13%	0.00%	NA
Aus	269	37.20%	62.50%	0.37%	0.00%	NA
Indica I	595	94.30%	5.70%	0.00%	0.00%	NA
Indica II	465	61.50%	38.30%	0.00%	0.22%	NA
Indica III	913	57.80%	42.10%	0.11%	0.00%	NA
Indica Intermediate	786	62.30%	37.30%	0.38%	0.00%	NA
Temperate Japonica	767	6.30%	93.50%	0.26%	0.00%	NA
Tropical Japonica	504	76.80%	23.20%	0.00%	0.00%	NA
Japonica Intermediate	241	27.40%	72.60%	0.00%	0.00%	NA
VI/Aromatic	96	4.20%	95.80%	0.00%	0.00%	NA
Intermediate	90	47.80%	51.10%	1.11%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1125214331	G -> A	LOC_Os11g41910.1	synonymous_variant ; p.Arg113Arg; LOW	synonymous_codon	Average:46.668; most accessible tissue: Zhenshan97 panicle, score: 69.946	N	N	N	N
vg1125214331	G -> DEL	LOC_Os11g41910.1	N	frameshift_variant	Average:46.668; most accessible tissue: Zhenshan97 panicle, score: 69.946	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1125214331	NA	1.52E-07	mr1217	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125214331	NA	8.88E-06	mr1364	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125214331	NA	6.87E-06	mr1382	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125214331	NA	3.21E-06	mr1443	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125214331	NA	3.79E-07	mr1518	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125214331	NA	2.48E-07	mr1551	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125214331	NA	1.39E-06	mr1742	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125214331	NA	7.49E-08	mr1845	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125214331	NA	2.36E-07	mr1090_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125214331	NA	1.39E-06	mr1096_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125214331	NA	1.05E-07	mr1121_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125214331	8.94E-06	NA	mr1191_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125214331	NA	9.32E-07	mr1211_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125214331	NA	5.20E-07	mr1248_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125214331	NA	7.00E-09	mr1250_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125214331	NA	8.22E-11	mr1471_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125214331	NA	1.62E-08	mr1498_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125214331	NA	1.10E-14	mr1539_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125214331	NA	7.82E-16	mr1540_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125214331	NA	1.31E-09	mr1642_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125214331	NA	5.07E-07	mr1679_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125214331	NA	4.69E-18	mr1699_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125214331	NA	1.74E-14	mr1732_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125214331	NA	3.44E-07	mr1733_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125214331	NA	1.97E-07	mr1817_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125214331	NA	4.89E-07	mr1925_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251