\
| Variant ID: vg1125203416 (JBrowse) | Variation Type: SNP |
| Chromosome: chr11 | Position: 25203416 |
| Reference Allele: C | Alternative Allele: T |
| Primary Allele: T | Secondary Allele: C |
Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.66, T: 0.33, others allele: 0.00, population size: 241. )
TTACATTAGGTTATGGATCTCCAGTAATTACAAAGAACTGAACCCGATAGGCTGCTTCTCCATCAGATTTCTAGCAAAAGCAGAACACATCTTTTCTGAT[C/T]
TTAGTTGATGGACATCAAATTTTCTTCAAGATTGCTTCATACCATTCCATTCCACATTGTACAGCTTCCATAAAAGTTGGTTGCACGCATATTTTCATGT
ACATGAAAATATGCGTGCAACCAACTTTTATGGAAGCTGTACAATGTGGAATGGAATGGTATGAAGCAATCTTGAAGAAAATTTGATGTCCATCAACTAA[G/A]
ATCAGAAAAGATGTGTTCTGCTTTTGCTAGAAATCTGATGGAGAAGCAGCCTATCGGGTTCAGTTCTTTGTAATTACTGGAGATCCATAACCTAATGTAA
| Populations | Population Size | Frequency of T(primary allele) | Frequency of C(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 55.70% | 43.70% | 0.19% | 0.34% | NA |
| All Indica | 2759 | 82.60% | 16.90% | 0.14% | 0.29% | NA |
| All Japonica | 1512 | 13.70% | 85.70% | 0.26% | 0.33% | NA |
| Aus | 269 | 39.80% | 59.50% | 0.00% | 0.74% | NA |
| Indica I | 595 | 64.50% | 35.00% | 0.34% | 0.17% | NA |
| Indica II | 465 | 75.90% | 23.70% | 0.22% | 0.22% | NA |
| Indica III | 913 | 95.00% | 4.70% | 0.00% | 0.33% | NA |
| Indica Intermediate | 786 | 86.00% | 13.50% | 0.13% | 0.38% | NA |
| Temperate Japonica | 767 | 3.00% | 96.90% | 0.13% | 0.00% | NA |
| Tropical Japonica | 504 | 30.20% | 68.80% | 0.20% | 0.79% | NA |
| Japonica Intermediate | 241 | 13.30% | 85.50% | 0.83% | 0.41% | NA |
| VI/Aromatic | 96 | 1.00% | 99.00% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 43.30% | 54.40% | 1.11% | 1.11% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1125203416 | C -> T | LOC_Os11g41900.1 | intron_variant ; MODIFIER | silent_mutation | Average:49.487; most accessible tissue: Minghui63 flag leaf, score: 63.086 | N | N | N | N |
| vg1125203416 | C -> DEL | N | N | silent_mutation | Average:49.487; most accessible tissue: Minghui63 flag leaf, score: 63.086 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1125203416 | NA | 8.87E-19 | mr1133 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1125203416 | 2.51E-12 | NA | mr1191 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1125203416 | 5.59E-16 | 4.08E-18 | mr1191 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1125203416 | 1.87E-11 | NA | mr1644 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1125203416 | 4.77E-15 | 3.73E-19 | mr1644 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1125203416 | 3.04E-12 | 5.26E-07 | mr1662 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1125203416 | 2.72E-08 | 2.05E-10 | mr1662 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1125203416 | NA | 7.36E-06 | mr1662 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1125203416 | NA | 6.77E-07 | mr1696 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1125203416 | NA | 1.69E-06 | mr1745 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1125203416 | NA | 1.61E-18 | mr1133_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1125203416 | NA | 4.92E-06 | mr1133_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1125203416 | 1.67E-13 | NA | mr1191_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1125203416 | 1.97E-17 | 2.40E-25 | mr1191_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1125203416 | NA | 2.19E-07 | mr1530_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1125203416 | 6.86E-10 | NA | mr1662_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1125203416 | 5.80E-06 | 3.58E-10 | mr1662_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1125203416 | 1.52E-06 | 2.95E-06 | mr1662_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1125203416 | NA | 1.36E-11 | mr1667_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1125203416 | NA | 3.17E-09 | mr1745_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |