Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1125185431:

Variant ID: vg1125185431 (JBrowse)Variation Type: SNP
Chromosome: chr11Position: 25185431
Reference Allele: GAlternative Allele: A
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 1.00, others allele: 0.00, population size: 117. )

Flanking Sequence (100 bp) in Reference Genome:


ATCATGCATAATGCATTATTCATGTTTTATCATCCAACAATAATAAAAATACTAATCATAAAAAAAAATTATATAAGACGAACGGTCAAACATTGGATAT[G/A]
GAAATCCAAGAATTAAGTCTTTTTGGGACGGATGGAGTACTTTCATCTCCCCCGTCACTACTGCGGCTGCACACGCTCAGTTGTAGAGTACTTGCTCAGT

Reverse complement sequence

ACTGAGCAAGTACTCTACAACTGAGCGTGTGCAGCCGCAGTAGTGACGGGGGAGATGAAAGTACTCCATCCGTCCCAAAAAGACTTAATTCTTGGATTTC[C/T]
ATATCCAATGTTTGACCGTTCGTCTTATATAATTTTTTTTTATGATTAGTATTTTTATTATTGTTGGATGATAAAACATGAATAATGCATTATGCATGAT

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 93.70% 5.50% 0.08% 0.68% NA
All Indica  2759 93.90% 5.90% 0.14% 0.07% NA
All Japonica  1512 98.20% 0.20% 0.00% 1.59% NA
Aus  269 63.60% 35.30% 0.00% 1.12% NA
Indica I  595 98.50% 1.50% 0.00% 0.00% NA
Indica II  465 84.90% 15.10% 0.00% 0.00% NA
Indica III  913 97.50% 2.40% 0.11% 0.00% NA
Indica Intermediate  786 91.60% 7.80% 0.38% 0.25% NA
Temperate Japonica  767 97.10% 0.30% 0.00% 2.61% NA
Tropical Japonica  504 99.40% 0.20% 0.00% 0.40% NA
Japonica Intermediate  241 99.20% 0.00% 0.00% 0.83% NA
VI/Aromatic  96 99.00% 0.00% 0.00% 1.04% NA
Intermediate  90 95.60% 2.20% 0.00% 2.22% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1125185431 G -> A LOC_Os11g41880.1 upstream_gene_variant ; 1955.0bp to feature; MODIFIER silent_mutation Average:77.914; most accessible tissue: Callus, score: 96.7 N N N N
vg1125185431 G -> A LOC_Os11g41880-LOC_Os11g41890 intergenic_region ; MODIFIER silent_mutation Average:77.914; most accessible tissue: Callus, score: 96.7 N N N N
vg1125185431 G -> DEL N N silent_mutation Average:77.914; most accessible tissue: Callus, score: 96.7 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg1125185431 G A 0.02 0.02 0.01 -0.01 0.0 -0.01

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1125185431 1.99E-16 3.14E-18 mr1238 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125185431 3.10E-09 2.01E-10 mr1309 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125185431 1.71E-06 2.27E-07 mr1484 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125185431 9.32E-09 7.33E-10 mr1841 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125185431 3.96E-06 3.96E-06 mr1900 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125185431 4.02E-06 4.02E-06 mr1945 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125185431 1.01E-11 1.87E-13 mr1238_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125185431 1.08E-10 5.90E-13 mr1484_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125185431 NA 8.54E-06 mr1609_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125185431 2.29E-12 7.46E-14 mr1841_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125185431 5.03E-07 8.12E-09 mr1900_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125185431 2.55E-08 2.55E-08 mr1945_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251