\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1125185398:

Variant ID: vg1125185398 (JBrowse)Variation Type: INDEL
Chromosome: chr11Position: 25185398
Reference Allele: AAlternative Allele: T,AT
Primary Allele: ASecondary Allele: T

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.92, T: 0.09, G: 0.01, others allele: 0.00, population size: 82. )

Flanking Sequence (100 bp) in Reference Genome:


TTTAAAAAATATATAAAAAAAATAAACAGATAAATCATGCATAATGCATTATTCATGTTTTATCATCCAACAATAATAAAAATACTAATCATAAAAAAAA[A/T,AT]
TTATATAAGACGAACGGTCAAACATTGGATATGGAAATCCAAGAATTAAGTCTTTTTGGGACGGATGGAGTACTTTCATCTCCCCCGTCACTACTGCGGC

Reverse complement sequence

GCCGCAGTAGTGACGGGGGAGATGAAAGTACTCCATCCGTCCCAAAAAGACTTAATTCTTGGATTTCCATATCCAATGTTTGACCGTTCGTCTTATATAA[T/A,AT]
TTTTTTTTATGATTAGTATTTTTATTATTGTTGGATGATAAAACATGAATAATGCATTATGCATGATTTATCTGTTTATTTTTTTTATATATTTTTTAAA

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 56.30% 41.70% 1.33% 0.36% AT: 0.32%
All Indica  2759 37.90% 60.90% 1.01% 0.07% AT: 0.04%
All Japonica  1512 88.10% 8.30% 1.85% 0.93% AT: 0.86%
Aus  269 48.30% 50.20% 1.12% 0.37% NA
Indica I  595 63.00% 35.10% 1.85% 0.00% NA
Indica II  465 41.50% 57.80% 0.65% 0.00% NA
Indica III  913 23.00% 76.90% 0.11% 0.00% NA
Indica Intermediate  786 34.20% 63.70% 1.65% 0.25% AT: 0.13%
Temperate Japonica  767 94.50% 2.70% 1.43% 1.30% NA
Tropical Japonica  504 81.30% 15.10% 1.39% 0.40% AT: 1.79%
Japonica Intermediate  241 81.70% 11.60% 4.15% 0.83% AT: 1.66%
VI/Aromatic  96 93.80% 5.20% 0.00% 0.00% AT: 1.04%
Intermediate  90 67.80% 27.80% 4.44% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1125185398 A -> AT LOC_Os11g41880.1 upstream_gene_variant ; 1923.0bp to feature; MODIFIER silent_mutation Average:86.1; most accessible tissue: Minghui63 root, score: 94.116 N N N N
vg1125185398 A -> AT LOC_Os11g41880-LOC_Os11g41890 intergenic_region ; MODIFIER silent_mutation Average:86.1; most accessible tissue: Minghui63 root, score: 94.116 N N N N
vg1125185398 A -> T LOC_Os11g41880.1 upstream_gene_variant ; 1922.0bp to feature; MODIFIER silent_mutation Average:86.1; most accessible tissue: Minghui63 root, score: 94.116 N N N N
vg1125185398 A -> T LOC_Os11g41880-LOC_Os11g41890 intergenic_region ; MODIFIER silent_mutation Average:86.1; most accessible tissue: Minghui63 root, score: 94.116 N N N N
vg1125185398 A -> DEL N N silent_mutation Average:86.1; most accessible tissue: Minghui63 root, score: 94.116 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg1125185398 A AT 0.0 -0.07 -0.06 -0.01 -0.03 -0.03
vg1125185398 A T -0.02 0.0 -0.01 -0.01 -0.01 -0.01

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1125185398 1.09E-06 2.14E-06 mr1036 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125185398 4.15E-08 2.47E-09 mr1191 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125185398 4.89E-08 1.37E-11 mr1644 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125185398 NA 2.26E-07 mr1745 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125185398 6.34E-06 NA mr1748 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125185398 6.96E-06 6.71E-12 mr1191_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125185398 NA 3.58E-06 mr1662_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125185398 NA 4.20E-09 mr1745_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125185398 NA 3.88E-06 mr1855_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251