\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1125184358:

Variant ID: vg1125184358 (JBrowse)Variation Type: SNP
Chromosome: chr11Position: 25184358
Reference Allele: CAlternative Allele: T
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.93, T: 0.08, others allele: 0.00, population size: 227. )

Flanking Sequence (100 bp) in Reference Genome:


AGAGACACATAAAGGTACGATTCTATTTCAAATAGATCAATTTTACAGTATTTAAGATACTTATTACTTTGTGGTATCAAATTTATGAAATGCAGTATCT[C/T]
CTGGGTTTATTTTTTTCAAGGATAGTAAAATCACCCTTTCAAATAACCTCGCACACGCGTGAAATCAAACTAGTTTGCGCATAACGCCTATAATTCTTAG

Reverse complement sequence

CTAAGAATTATAGGCGTTATGCGCAAACTAGTTTGATTTCACGCGTGTGCGAGGTTATTTGAAAGGGTGATTTTACTATCCTTGAAAAAAATAAACCCAG[G/A]
AGATACTGCATTTCATAAATTTGATACCACAAAGTAATAAGTATCTTAAATACTGTAAAATTGATCTATTTGAAATAGAATCGTACCTTTATGTGTCTCT

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 88.40% 11.50% 0.11% 0.00% NA
All Indica  2759 82.10% 17.80% 0.07% 0.00% NA
All Japonica  1512 99.90% 0.10% 0.00% 0.00% NA
Aus  269 84.40% 14.50% 1.12% 0.00% NA
Indica I  595 69.60% 30.30% 0.17% 0.00% NA
Indica II  465 84.50% 15.50% 0.00% 0.00% NA
Indica III  913 86.10% 13.90% 0.00% 0.00% NA
Indica Intermediate  786 85.60% 14.20% 0.13% 0.00% NA
Temperate Japonica  767 100.00% 0.00% 0.00% 0.00% NA
Tropical Japonica  504 99.80% 0.20% 0.00% 0.00% NA
Japonica Intermediate  241 99.60% 0.40% 0.00% 0.00% NA
VI/Aromatic  96 92.70% 7.30% 0.00% 0.00% NA
Intermediate  90 93.30% 6.70% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1125184358 C -> T LOC_Os11g41880.1 upstream_gene_variant ; 882.0bp to feature; MODIFIER silent_mutation Average:55.577; most accessible tissue: Zhenshan97 flower, score: 72.863 N N N N
vg1125184358 C -> T LOC_Os11g41875.2 upstream_gene_variant ; 4086.0bp to feature; MODIFIER silent_mutation Average:55.577; most accessible tissue: Zhenshan97 flower, score: 72.863 N N N N
vg1125184358 C -> T LOC_Os11g41880-LOC_Os11g41890 intergenic_region ; MODIFIER silent_mutation Average:55.577; most accessible tissue: Zhenshan97 flower, score: 72.863 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1125184358 1.89E-08 NA mr1238 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125184358 3.36E-07 2.31E-06 mr1238_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125184358 2.30E-06 2.43E-06 mr1484_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125184358 1.53E-06 NA mr1841_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251