\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1125163575:

Variant ID: vg1125163575 (JBrowse)Variation Type: SNP
Chromosome: chr11Position: 25163575
Reference Allele: CAlternative Allele: T
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.77, T: 0.23, others allele: 0.00, population size: 250. )

Flanking Sequence (100 bp) in Reference Genome:


CTGTTACAGATTCCAAAACCCGCACTCGAAGTCAATAAGATTACAAAATAGAGTACACATCAGACACACAGCTATAGGGCTCCCTGATTCCACAACAATC[C/T]
GTAGAAGGCTAGCAGCCAACACAGAAGAAAATAAAAACAAAGGGGAAATCCTAAATTCCTAATGATACATTTGAGTTGGAGACTGGGGGAGCTTAGGTGT

Reverse complement sequence

ACACCTAAGCTCCCCCAGTCTCCAACTCAAATGTATCATTAGGAATTTAGGATTTCCCCTTTGTTTTTATTTTCTTCTGTGTTGGCTGCTAGCCTTCTAC[G/A]
GATTGTTGTGGAATCAGGGAGCCCTATAGCTGTGTGTCTGATGTGTACTCTATTTTGTAATCTTATTGACTTCGAGTGCGGGTTTTGGAATCTGTAACAG

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 59.90% 39.80% 0.25% 0.00% NA
All Indica  2759 54.70% 45.00% 0.29% 0.00% NA
All Japonica  1512 74.80% 25.10% 0.07% 0.00% NA
Aus  269 30.50% 69.50% 0.00% 0.00% NA
Indica I  595 65.20% 34.30% 0.50% 0.00% NA
Indica II  465 47.10% 52.90% 0.00% 0.00% NA
Indica III  913 57.60% 42.30% 0.11% 0.00% NA
Indica Intermediate  786 48.00% 51.50% 0.51% 0.00% NA
Temperate Japonica  767 94.30% 5.70% 0.00% 0.00% NA
Tropical Japonica  504 44.80% 55.00% 0.20% 0.00% NA
Japonica Intermediate  241 75.50% 24.50% 0.00% 0.00% NA
VI/Aromatic  96 55.20% 44.80% 0.00% 0.00% NA
Intermediate  90 61.10% 35.60% 3.33% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1125163575 C -> T LOC_Os11g41840.1 upstream_gene_variant ; 1932.0bp to feature; MODIFIER silent_mutation Average:62.739; most accessible tissue: Callus, score: 85.608 N N N N
vg1125163575 C -> T LOC_Os11g41850.1 downstream_gene_variant ; 2208.0bp to feature; MODIFIER silent_mutation Average:62.739; most accessible tissue: Callus, score: 85.608 N N N N
vg1125163575 C -> T LOC_Os11g41840-LOC_Os11g41850 intergenic_region ; MODIFIER silent_mutation Average:62.739; most accessible tissue: Callus, score: 85.608 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1125163575 5.50E-08 NA mr1191 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125163575 4.63E-09 2.26E-11 mr1191 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125163575 8.10E-11 NA mr1644 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125163575 1.00E-13 9.83E-16 mr1644 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125163575 NA 4.01E-08 mr1723 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125163575 2.85E-07 NA mr1191_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125163575 3.05E-09 7.19E-15 mr1191_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125163575 NA 5.95E-06 mr1206_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125163575 NA 8.25E-08 mr1723_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125163575 NA 7.60E-09 mr1746_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125163575 NA 1.49E-09 mr1825_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125163575 NA 2.41E-06 mr1841_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251