\
| Variant ID: vg1125163575 (JBrowse) | Variation Type: SNP |
| Chromosome: chr11 | Position: 25163575 |
| Reference Allele: C | Alternative Allele: T |
| Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.77, T: 0.23, others allele: 0.00, population size: 250. )
CTGTTACAGATTCCAAAACCCGCACTCGAAGTCAATAAGATTACAAAATAGAGTACACATCAGACACACAGCTATAGGGCTCCCTGATTCCACAACAATC[C/T]
GTAGAAGGCTAGCAGCCAACACAGAAGAAAATAAAAACAAAGGGGAAATCCTAAATTCCTAATGATACATTTGAGTTGGAGACTGGGGGAGCTTAGGTGT
ACACCTAAGCTCCCCCAGTCTCCAACTCAAATGTATCATTAGGAATTTAGGATTTCCCCTTTGTTTTTATTTTCTTCTGTGTTGGCTGCTAGCCTTCTAC[G/A]
GATTGTTGTGGAATCAGGGAGCCCTATAGCTGTGTGTCTGATGTGTACTCTATTTTGTAATCTTATTGACTTCGAGTGCGGGTTTTGGAATCTGTAACAG
| Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 59.90% | 39.80% | 0.25% | 0.00% | NA |
| All Indica | 2759 | 54.70% | 45.00% | 0.29% | 0.00% | NA |
| All Japonica | 1512 | 74.80% | 25.10% | 0.07% | 0.00% | NA |
| Aus | 269 | 30.50% | 69.50% | 0.00% | 0.00% | NA |
| Indica I | 595 | 65.20% | 34.30% | 0.50% | 0.00% | NA |
| Indica II | 465 | 47.10% | 52.90% | 0.00% | 0.00% | NA |
| Indica III | 913 | 57.60% | 42.30% | 0.11% | 0.00% | NA |
| Indica Intermediate | 786 | 48.00% | 51.50% | 0.51% | 0.00% | NA |
| Temperate Japonica | 767 | 94.30% | 5.70% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 44.80% | 55.00% | 0.20% | 0.00% | NA |
| Japonica Intermediate | 241 | 75.50% | 24.50% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 55.20% | 44.80% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 61.10% | 35.60% | 3.33% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1125163575 | C -> T | LOC_Os11g41840.1 | upstream_gene_variant ; 1932.0bp to feature; MODIFIER | silent_mutation | Average:62.739; most accessible tissue: Callus, score: 85.608 | N | N | N | N |
| vg1125163575 | C -> T | LOC_Os11g41850.1 | downstream_gene_variant ; 2208.0bp to feature; MODIFIER | silent_mutation | Average:62.739; most accessible tissue: Callus, score: 85.608 | N | N | N | N |
| vg1125163575 | C -> T | LOC_Os11g41840-LOC_Os11g41850 | intergenic_region ; MODIFIER | silent_mutation | Average:62.739; most accessible tissue: Callus, score: 85.608 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1125163575 | 5.50E-08 | NA | mr1191 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1125163575 | 4.63E-09 | 2.26E-11 | mr1191 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1125163575 | 8.10E-11 | NA | mr1644 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1125163575 | 1.00E-13 | 9.83E-16 | mr1644 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1125163575 | NA | 4.01E-08 | mr1723 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1125163575 | 2.85E-07 | NA | mr1191_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1125163575 | 3.05E-09 | 7.19E-15 | mr1191_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1125163575 | NA | 5.95E-06 | mr1206_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1125163575 | NA | 8.25E-08 | mr1723_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1125163575 | NA | 7.60E-09 | mr1746_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1125163575 | NA | 1.49E-09 | mr1825_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1125163575 | NA | 2.41E-06 | mr1841_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |