Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1125163575:

Variant ID: vg1125163575 (JBrowse)	Variation Type: SNP
Chromosome: chr11	Position: 25163575
Reference Allele: C	Alternative Allele: T
Primary Allele: C	Secondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.77, T: 0.23, others allele: 0.00, population size: 250. )

Flanking Sequence (100 bp) in Reference Genome:

CTGTTACAGATTCCAAAACCCGCACTCGAAGTCAATAAGATTACAAAATAGAGTACACATCAGACACACAGCTATAGGGCTCCCTGATTCCACAACAATC[C/T]
GTAGAAGGCTAGCAGCCAACACAGAAGAAAATAAAAACAAAGGGGAAATCCTAAATTCCTAATGATACATTTGAGTTGGAGACTGGGGGAGCTTAGGTGT

Reverse complement sequence

ACACCTAAGCTCCCCCAGTCTCCAACTCAAATGTATCATTAGGAATTTAGGATTTCCCCTTTGTTTTTATTTTCTTCTGTGTTGGCTGCTAGCCTTCTAC[G/A]
GATTGTTGTGGAATCAGGGAGCCCTATAGCTGTGTGTCTGATGTGTACTCTATTTTGTAATCTTATTGACTTCGAGTGCGGGTTTTGGAATCTGTAACAG

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	59.90%	39.80%	0.25%	0.00%	NA
All Indica	2759	54.70%	45.00%	0.29%	0.00%	NA
All Japonica	1512	74.80%	25.10%	0.07%	0.00%	NA
Aus	269	30.50%	69.50%	0.00%	0.00%	NA
Indica I	595	65.20%	34.30%	0.50%	0.00%	NA
Indica II	465	47.10%	52.90%	0.00%	0.00%	NA
Indica III	913	57.60%	42.30%	0.11%	0.00%	NA
Indica Intermediate	786	48.00%	51.50%	0.51%	0.00%	NA
Temperate Japonica	767	94.30%	5.70%	0.00%	0.00%	NA
Tropical Japonica	504	44.80%	55.00%	0.20%	0.00%	NA
Japonica Intermediate	241	75.50%	24.50%	0.00%	0.00%	NA
VI/Aromatic	96	55.20%	44.80%	0.00%	0.00%	NA
Intermediate	90	61.10%	35.60%	3.33%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1125163575	C -> T	LOC_Os11g41840.1	upstream_gene_variant ; 1932.0bp to feature; MODIFIER	silent_mutation	Average:62.739; most accessible tissue: Callus, score: 85.608	N	N	N	N
vg1125163575	C -> T	LOC_Os11g41850.1	downstream_gene_variant ; 2208.0bp to feature; MODIFIER	silent_mutation	Average:62.739; most accessible tissue: Callus, score: 85.608	N	N	N	N
vg1125163575	C -> T	LOC_Os11g41840-LOC_Os11g41850	intergenic_region ; MODIFIER	silent_mutation	Average:62.739; most accessible tissue: Callus, score: 85.608	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1125163575	5.50E-08	NA	mr1191	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125163575	4.63E-09	2.26E-11	mr1191	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125163575	8.10E-11	NA	mr1644	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125163575	1.00E-13	9.83E-16	mr1644	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125163575	NA	4.01E-08	mr1723	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125163575	2.85E-07	NA	mr1191_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125163575	3.05E-09	7.19E-15	mr1191_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125163575	NA	5.95E-06	mr1206_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125163575	NA	8.25E-08	mr1723_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125163575	NA	7.60E-09	mr1746_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125163575	NA	1.49E-09	mr1825_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125163575	NA	2.41E-06	mr1841_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251