\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1125162869:

Variant ID: vg1125162869 (JBrowse)Variation Type: SNP
Chromosome: chr11Position: 25162869
Reference Allele: CAlternative Allele: T
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.98, T: 0.01, others allele: 0.00, population size: 218. )

Flanking Sequence (100 bp) in Reference Genome:


TAGGGTGAAAATTTGGCTGGTAAGTTGGTCAATATTAGTAATTAATTGACATGATCATCTATCTATTGTATAGTAAAGTCCATTAAACTTTCTACAAACA[C/T]
TCTCAAACCACCACGTATGATTTCTACAAACGCTTCTAAATCACCAAATGACGCTCATAAGTTGCTCAAATAAATTAGATGAATTTCCAATAATACTAAA

Reverse complement sequence

TTTAGTATTATTGGAAATTCATCTAATTTATTTGAGCAACTTATGAGCGTCATTTGGTGATTTAGAAGCGTTTGTAGAAATCATACGTGGTGGTTTGAGA[G/A]
TGTTTGTAGAAAGTTTAATGGACTTTACTATACAATAGATAGATGATCATGTCAATTAATTACTAATATTGACCAACTTACCAGCCAAATTTTCACCCTA

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 65.80% 34.00% 0.17% 0.00% NA
All Indica  2759 48.10% 51.80% 0.14% 0.00% NA
All Japonica  1512 90.10% 9.60% 0.26% 0.00% NA
Aus  269 97.40% 2.60% 0.00% 0.00% NA
Indica I  595 36.30% 63.40% 0.34% 0.00% NA
Indica II  465 55.10% 44.90% 0.00% 0.00% NA
Indica III  913 43.60% 56.40% 0.00% 0.00% NA
Indica Intermediate  786 58.00% 41.70% 0.25% 0.00% NA
Temperate Japonica  767 94.90% 4.70% 0.39% 0.00% NA
Tropical Japonica  504 81.90% 18.10% 0.00% 0.00% NA
Japonica Intermediate  241 92.10% 7.50% 0.41% 0.00% NA
VI/Aromatic  96 99.00% 1.00% 0.00% 0.00% NA
Intermediate  90 73.30% 26.70% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1125162869 C -> T LOC_Os11g41840.1 upstream_gene_variant ; 1226.0bp to feature; MODIFIER silent_mutation Average:29.157; most accessible tissue: Callus, score: 58.43 N N N N
vg1125162869 C -> T LOC_Os11g41850.1 downstream_gene_variant ; 2914.0bp to feature; MODIFIER silent_mutation Average:29.157; most accessible tissue: Callus, score: 58.43 N N N N
vg1125162869 C -> T LOC_Os11g41840-LOC_Os11g41850 intergenic_region ; MODIFIER silent_mutation Average:29.157; most accessible tissue: Callus, score: 58.43 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1125162869 1.19E-06 NA mr1133 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125162869 6.41E-06 2.88E-13 mr1191 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125162869 2.76E-09 1.13E-12 mr1191 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125162869 NA 7.57E-06 mr1484 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125162869 4.33E-11 1.88E-17 mr1644 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125162869 9.40E-15 7.30E-18 mr1644 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125162869 1.57E-06 1.57E-06 mr1945 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125162869 NA 9.60E-06 mr1027_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125162869 6.31E-07 3.85E-21 mr1191_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125162869 2.99E-10 4.86E-18 mr1191_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125162869 2.11E-06 NA mr1841_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125162869 NA 1.60E-12 mr1850_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251