\
| Variant ID: vg1125162869 (JBrowse) | Variation Type: SNP |
| Chromosome: chr11 | Position: 25162869 |
| Reference Allele: C | Alternative Allele: T |
| Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.98, T: 0.01, others allele: 0.00, population size: 218. )
TAGGGTGAAAATTTGGCTGGTAAGTTGGTCAATATTAGTAATTAATTGACATGATCATCTATCTATTGTATAGTAAAGTCCATTAAACTTTCTACAAACA[C/T]
TCTCAAACCACCACGTATGATTTCTACAAACGCTTCTAAATCACCAAATGACGCTCATAAGTTGCTCAAATAAATTAGATGAATTTCCAATAATACTAAA
TTTAGTATTATTGGAAATTCATCTAATTTATTTGAGCAACTTATGAGCGTCATTTGGTGATTTAGAAGCGTTTGTAGAAATCATACGTGGTGGTTTGAGA[G/A]
TGTTTGTAGAAAGTTTAATGGACTTTACTATACAATAGATAGATGATCATGTCAATTAATTACTAATATTGACCAACTTACCAGCCAAATTTTCACCCTA
| Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 65.80% | 34.00% | 0.17% | 0.00% | NA |
| All Indica | 2759 | 48.10% | 51.80% | 0.14% | 0.00% | NA |
| All Japonica | 1512 | 90.10% | 9.60% | 0.26% | 0.00% | NA |
| Aus | 269 | 97.40% | 2.60% | 0.00% | 0.00% | NA |
| Indica I | 595 | 36.30% | 63.40% | 0.34% | 0.00% | NA |
| Indica II | 465 | 55.10% | 44.90% | 0.00% | 0.00% | NA |
| Indica III | 913 | 43.60% | 56.40% | 0.00% | 0.00% | NA |
| Indica Intermediate | 786 | 58.00% | 41.70% | 0.25% | 0.00% | NA |
| Temperate Japonica | 767 | 94.90% | 4.70% | 0.39% | 0.00% | NA |
| Tropical Japonica | 504 | 81.90% | 18.10% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 92.10% | 7.50% | 0.41% | 0.00% | NA |
| VI/Aromatic | 96 | 99.00% | 1.00% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 73.30% | 26.70% | 0.00% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1125162869 | C -> T | LOC_Os11g41840.1 | upstream_gene_variant ; 1226.0bp to feature; MODIFIER | silent_mutation | Average:29.157; most accessible tissue: Callus, score: 58.43 | N | N | N | N |
| vg1125162869 | C -> T | LOC_Os11g41850.1 | downstream_gene_variant ; 2914.0bp to feature; MODIFIER | silent_mutation | Average:29.157; most accessible tissue: Callus, score: 58.43 | N | N | N | N |
| vg1125162869 | C -> T | LOC_Os11g41840-LOC_Os11g41850 | intergenic_region ; MODIFIER | silent_mutation | Average:29.157; most accessible tissue: Callus, score: 58.43 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1125162869 | 1.19E-06 | NA | mr1133 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1125162869 | 6.41E-06 | 2.88E-13 | mr1191 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1125162869 | 2.76E-09 | 1.13E-12 | mr1191 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1125162869 | NA | 7.57E-06 | mr1484 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1125162869 | 4.33E-11 | 1.88E-17 | mr1644 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1125162869 | 9.40E-15 | 7.30E-18 | mr1644 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1125162869 | 1.57E-06 | 1.57E-06 | mr1945 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1125162869 | NA | 9.60E-06 | mr1027_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1125162869 | 6.31E-07 | 3.85E-21 | mr1191_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1125162869 | 2.99E-10 | 4.86E-18 | mr1191_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1125162869 | 2.11E-06 | NA | mr1841_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1125162869 | NA | 1.60E-12 | mr1850_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |