Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923).

Detailed information for vg1125162869:

Variant ID: vg1125162869 (JBrowse)	Variation Type: SNP
Chromosome: chr11	Position: 25162869
Reference Allele: C	Alternative Allele: T
Primary Allele: C	Secondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.98, T: 0.01, others allele: 0.00, population size: 218. )

Flanking Sequence (100 bp) in Reference Genome:

TAGGGTGAAAATTTGGCTGGTAAGTTGGTCAATATTAGTAATTAATTGACATGATCATCTATCTATTGTATAGTAAAGTCCATTAAACTTTCTACAAACA[C/T]
TCTCAAACCACCACGTATGATTTCTACAAACGCTTCTAAATCACCAAATGACGCTCATAAGTTGCTCAAATAAATTAGATGAATTTCCAATAATACTAAA

Reverse complement sequence

TTTAGTATTATTGGAAATTCATCTAATTTATTTGAGCAACTTATGAGCGTCATTTGGTGATTTAGAAGCGTTTGTAGAAATCATACGTGGTGGTTTGAGA[G/A]
TGTTTGTAGAAAGTTTAATGGACTTTACTATACAATAGATAGATGATCATGTCAATTAATTACTAATATTGACCAACTTACCAGCCAAATTTTCACCCTA

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	65.80%	34.00%	0.17%	0.00%	NA
All Indica	2759	48.10%	51.80%	0.14%	0.00%	NA
All Japonica	1512	90.10%	9.60%	0.26%	0.00%	NA
Aus	269	97.40%	2.60%	0.00%	0.00%	NA
Indica I	595	36.30%	63.40%	0.34%	0.00%	NA
Indica II	465	55.10%	44.90%	0.00%	0.00%	NA
Indica III	913	43.60%	56.40%	0.00%	0.00%	NA
Indica Intermediate	786	58.00%	41.70%	0.25%	0.00%	NA
Temperate Japonica	767	94.90%	4.70%	0.39%	0.00%	NA
Tropical Japonica	504	81.90%	18.10%	0.00%	0.00%	NA
Japonica Intermediate	241	92.10%	7.50%	0.41%	0.00%	NA
VI/Aromatic	96	99.00%	1.00%	0.00%	0.00%	NA
Intermediate	90	73.30%	26.70%	0.00%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1125162869	C -> T	LOC_Os11g41840.1	upstream_gene_variant ; 1226.0bp to feature; MODIFIER	silent_mutation	Average:29.157; most accessible tissue: Callus, score: 58.43	N	N	N	N
vg1125162869	C -> T	LOC_Os11g41850.1	downstream_gene_variant ; 2914.0bp to feature; MODIFIER	silent_mutation	Average:29.157; most accessible tissue: Callus, score: 58.43	N	N	N	N
vg1125162869	C -> T	LOC_Os11g41840-LOC_Os11g41850	intergenic_region ; MODIFIER	silent_mutation	Average:29.157; most accessible tissue: Callus, score: 58.43	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1125162869	1.19E-06	NA	mr1133	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125162869	6.41E-06	2.88E-13	mr1191	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125162869	2.76E-09	1.13E-12	mr1191	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125162869	NA	7.57E-06	mr1484	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125162869	4.33E-11	1.88E-17	mr1644	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125162869	9.40E-15	7.30E-18	mr1644	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125162869	1.57E-06	1.57E-06	mr1945	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125162869	NA	9.60E-06	mr1027_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125162869	6.31E-07	3.85E-21	mr1191_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125162869	2.99E-10	4.86E-18	mr1191_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125162869	2.11E-06	NA	mr1841_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125162869	NA	1.60E-12	mr1850_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251