\
| Variant ID: vg1125162381 (JBrowse) | Variation Type: SNP |
| Chromosome: chr11 | Position: 25162381 |
| Reference Allele: A | Alternative Allele: C |
| Primary Allele: A | Secondary Allele: C |
Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.99, C: 0.01, others allele: 0.00, population size: 126. )
ATATAACAATATTTTCAACATAAACAAAGAAACTATTAAAATATATTTAATATTAGATTTAATAAGACTAAAATAATGCTATAAATGTTGCTATTCTATA[A/C]
ATTTAATCAAATTTTTAAGAAGTTTGACTTAAAAAAAATAAAAAAACTTACTACAATATAAAACGGATGAAATAAGTGATTGTTTAGCGTGACCATGATG
CATCATGGTCACGCTAAACAATCACTTATTTCATCCGTTTTATATTGTAGTAAGTTTTTTTATTTTTTTTAAGTCAAACTTCTTAAAAATTTGATTAAAT[T/G]
TATAGAATAGCAACATTTATAGCATTATTTTAGTCTTATTAAATCTAATATTAAATATATTTTAATAGTTTCTTTGTTTATGTTGAAAATATTGTTATAT
| Populations | Population Size | Frequency of A(primary allele) | Frequency of C(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 80.40% | 19.50% | 0.06% | 0.00% | NA |
| All Indica | 2759 | 67.60% | 32.30% | 0.11% | 0.00% | NA |
| All Japonica | 1512 | 99.30% | 0.70% | 0.00% | 0.00% | NA |
| Aus | 269 | 97.40% | 2.60% | 0.00% | 0.00% | NA |
| Indica I | 595 | 39.50% | 60.50% | 0.00% | 0.00% | NA |
| Indica II | 465 | 72.30% | 27.70% | 0.00% | 0.00% | NA |
| Indica III | 913 | 75.70% | 24.10% | 0.22% | 0.00% | NA |
| Indica Intermediate | 786 | 76.80% | 23.00% | 0.13% | 0.00% | NA |
| Temperate Japonica | 767 | 98.80% | 1.20% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 99.80% | 0.20% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 99.60% | 0.40% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 83.30% | 16.70% | 0.00% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1125162381 | A -> C | LOC_Os11g41840.1 | upstream_gene_variant ; 738.0bp to feature; MODIFIER | silent_mutation | Average:26.357; most accessible tissue: Callus, score: 38.887 | N | N | N | N |
| vg1125162381 | A -> C | LOC_Os11g41850.1 | downstream_gene_variant ; 3402.0bp to feature; MODIFIER | silent_mutation | Average:26.357; most accessible tissue: Callus, score: 38.887 | N | N | N | N |
| vg1125162381 | A -> C | LOC_Os11g41840-LOC_Os11g41850 | intergenic_region ; MODIFIER | silent_mutation | Average:26.357; most accessible tissue: Callus, score: 38.887 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1125162381 | 1.63E-08 | 2.21E-16 | mr1191 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1125162381 | 4.92E-08 | 1.33E-10 | mr1191 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1125162381 | 1.59E-12 | 1.33E-17 | mr1644 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1125162381 | 1.64E-11 | 4.60E-12 | mr1644 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1125162381 | NA | 3.10E-06 | mr1662 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1125162381 | 8.92E-11 | 3.16E-27 | mr1191_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1125162381 | 1.57E-09 | 8.85E-17 | mr1191_2 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |