\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1125162381:

Variant ID: vg1125162381 (JBrowse)Variation Type: SNP
Chromosome: chr11Position: 25162381
Reference Allele: AAlternative Allele: C
Primary Allele: ASecondary Allele: C

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.99, C: 0.01, others allele: 0.00, population size: 126. )

Flanking Sequence (100 bp) in Reference Genome:


ATATAACAATATTTTCAACATAAACAAAGAAACTATTAAAATATATTTAATATTAGATTTAATAAGACTAAAATAATGCTATAAATGTTGCTATTCTATA[A/C]
ATTTAATCAAATTTTTAAGAAGTTTGACTTAAAAAAAATAAAAAAACTTACTACAATATAAAACGGATGAAATAAGTGATTGTTTAGCGTGACCATGATG

Reverse complement sequence

CATCATGGTCACGCTAAACAATCACTTATTTCATCCGTTTTATATTGTAGTAAGTTTTTTTATTTTTTTTAAGTCAAACTTCTTAAAAATTTGATTAAAT[T/G]
TATAGAATAGCAACATTTATAGCATTATTTTAGTCTTATTAAATCTAATATTAAATATATTTTAATAGTTTCTTTGTTTATGTTGAAAATATTGTTATAT

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 80.40% 19.50% 0.06% 0.00% NA
All Indica  2759 67.60% 32.30% 0.11% 0.00% NA
All Japonica  1512 99.30% 0.70% 0.00% 0.00% NA
Aus  269 97.40% 2.60% 0.00% 0.00% NA
Indica I  595 39.50% 60.50% 0.00% 0.00% NA
Indica II  465 72.30% 27.70% 0.00% 0.00% NA
Indica III  913 75.70% 24.10% 0.22% 0.00% NA
Indica Intermediate  786 76.80% 23.00% 0.13% 0.00% NA
Temperate Japonica  767 98.80% 1.20% 0.00% 0.00% NA
Tropical Japonica  504 99.80% 0.20% 0.00% 0.00% NA
Japonica Intermediate  241 99.60% 0.40% 0.00% 0.00% NA
VI/Aromatic  96 100.00% 0.00% 0.00% 0.00% NA
Intermediate  90 83.30% 16.70% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1125162381 A -> C LOC_Os11g41840.1 upstream_gene_variant ; 738.0bp to feature; MODIFIER silent_mutation Average:26.357; most accessible tissue: Callus, score: 38.887 N N N N
vg1125162381 A -> C LOC_Os11g41850.1 downstream_gene_variant ; 3402.0bp to feature; MODIFIER silent_mutation Average:26.357; most accessible tissue: Callus, score: 38.887 N N N N
vg1125162381 A -> C LOC_Os11g41840-LOC_Os11g41850 intergenic_region ; MODIFIER silent_mutation Average:26.357; most accessible tissue: Callus, score: 38.887 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1125162381 1.63E-08 2.21E-16 mr1191 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125162381 4.92E-08 1.33E-10 mr1191 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125162381 1.59E-12 1.33E-17 mr1644 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125162381 1.64E-11 4.60E-12 mr1644 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125162381 NA 3.10E-06 mr1662 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125162381 8.92E-11 3.16E-27 mr1191_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125162381 1.57E-09 8.85E-17 mr1191_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251