\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1125162180:

Variant ID: vg1125162180 (JBrowse)Variation Type: SNP
Chromosome: chr11Position: 25162180
Reference Allele: GAlternative Allele: T
Primary Allele: TSecondary Allele: G

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


TTCTAACAGATATACATCTAAGCGAATTTAACACAGTAAATTTCATTCTAGCTAAACCATATGACAATAATAAGATTAAAATAGCATTCGCCTGTTACAG[G/T]
GCACGGTCATTTTTCTAGTACATATAAAATCAAAGATTTATAGGTCGCTTTGATTTTTTAAAAGTCAAACAACTTTAACTTTAGTTAAGTTTATAGAAAA

Reverse complement sequence

TTTTCTATAAACTTAACTAAAGTTAAAGTTGTTTGACTTTTAAAAAATCAAAGCGACCTATAAATCTTTGATTTTATATGTACTAGAAAAATGACCGTGC[C/A]
CTGTAACAGGCGAATGCTATTTTAATCTTATTATTGTCATATGGTTTAGCTAGAATGAAATTTACTGTGTTAAATTCGCTTAGATGTATATCTGTTAGAA

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 89.90% 7.20% 2.88% 0.00% NA
All Indica  2759 99.30% 0.50% 0.18% 0.00% NA
All Japonica  1512 71.20% 20.50% 8.33% 0.00% NA
Aus  269 99.30% 0.70% 0.00% 0.00% NA
Indica I  595 99.50% 0.20% 0.34% 0.00% NA
Indica II  465 98.70% 1.10% 0.22% 0.00% NA
Indica III  913 99.90% 0.10% 0.00% 0.00% NA
Indica Intermediate  786 98.70% 1.00% 0.25% 0.00% NA
Temperate Japonica  767 48.60% 37.00% 14.34% 0.00% NA
Tropical Japonica  504 98.60% 0.80% 0.60% 0.00% NA
Japonica Intermediate  241 85.50% 9.10% 5.39% 0.00% NA
VI/Aromatic  96 100.00% 0.00% 0.00% 0.00% NA
Intermediate  90 81.10% 13.30% 5.56% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1125162180 G -> T LOC_Os11g41840.1 upstream_gene_variant ; 537.0bp to feature; MODIFIER silent_mutation Average:31.189; most accessible tissue: Callus, score: 63.79 N N N N
vg1125162180 G -> T LOC_Os11g41850.1 downstream_gene_variant ; 3603.0bp to feature; MODIFIER silent_mutation Average:31.189; most accessible tissue: Callus, score: 63.79 N N N N
vg1125162180 G -> T LOC_Os11g41840-LOC_Os11g41850 intergenic_region ; MODIFIER silent_mutation Average:31.189; most accessible tissue: Callus, score: 63.79 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1125162180 1.36E-06 NA mr1238 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125162180 5.40E-08 NA mr1309 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125162180 4.93E-06 NA mr1309 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125162180 7.16E-06 7.16E-06 mr1609 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125162180 3.45E-06 NA mr1841 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125162180 2.41E-06 NA mr1900 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125162180 NA 9.66E-06 mr1900 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125162180 4.48E-06 NA mr1926 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125162180 9.68E-06 NA mr1238_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125162180 NA 5.68E-06 mr1296_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125162180 1.61E-06 NA mr1310_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125162180 2.01E-07 NA mr1609_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125162180 1.16E-06 1.16E-06 mr1609_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125162180 1.90E-07 NA mr1841_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125162180 9.54E-06 NA mr1841_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125162180 8.89E-06 NA mr1900_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125162180 NA 1.13E-07 mr1977_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125162180 NA 4.05E-06 mr1977_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251