\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1125153977:

Variant ID: vg1125153977 (JBrowse)Variation Type: SNP
Chromosome: chr11Position: 25153977
Reference Allele: CAlternative Allele: A
Primary Allele: ASecondary Allele: C

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


GAACGAGATTTCAAACCGAGATCAAATGGTGTTCACAACGAGTCGTCCGACACGATCACTTGTGGAACAGCGCGTCCATGTCCTCCAAGCTTCGCCCTCG[C/A]
GTCTCCGGCAGCCGCGCGTGCACGAACACGCACGCCGCCGCCGCCACGCCGGCGTAGAGGAAGAAGAACCCGACCATGGTGATCCCGCCGGCGACCGAGA

Reverse complement sequence

TCTCGGTCGCCGGCGGGATCACCATGGTCGGGTTCTTCTTCCTCTACGCCGGCGTGGCGGCGGCGGCGTGCGTGTTCGTGCACGCGCGGCTGCCGGAGAC[G/T]
CGAGGGCGAAGCTTGGAGGACATGGACGCGCTGTTCCACAAGTGATCGTGTCGGACGACTCGTTGTGAACACCATTTGATCTCGGTTTGAAATCTCGTTC

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 66.00% 33.90% 0.02% 0.00% NA
All Indica  2759 96.80% 3.10% 0.04% 0.00% NA
All Japonica  1512 13.30% 86.70% 0.00% 0.00% NA
Aus  269 57.60% 42.40% 0.00% 0.00% NA
Indica I  595 99.00% 1.00% 0.00% 0.00% NA
Indica II  465 96.30% 3.40% 0.22% 0.00% NA
Indica III  913 98.90% 1.10% 0.00% 0.00% NA
Indica Intermediate  786 93.10% 6.90% 0.00% 0.00% NA
Temperate Japonica  767 3.80% 96.20% 0.00% 0.00% NA
Tropical Japonica  504 27.40% 72.60% 0.00% 0.00% NA
Japonica Intermediate  241 14.10% 85.90% 0.00% 0.00% NA
VI/Aromatic  96 43.80% 56.20% 0.00% 0.00% NA
Intermediate  90 56.70% 43.30% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1125153977 C -> A LOC_Os11g41830.1 missense_variant ; p.Ala374Ser; MODERATE nonsynonymous_codon ; A374S Average:95.694; most accessible tissue: Zhenshan97 flag leaf, score: 96.514 unknown unknown TOLERATED 0.25

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg1125153977 C A -0.01 0.0 0.0 -0.01 -0.01 -0.01

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1125153977 NA 2.24E-06 mr1622 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125153977 NA 2.60E-25 mr1943 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251