| Variant ID: vg1125147337 (JBrowse) | Variation Type: SNP |
| Chromosome: chr11 | Position: 25147337 |
| Reference Allele: G | Alternative Allele: A |
| Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.97, A: 0.03, others allele: 0.00, population size: 117. )
TCGAGCAATTTTTGCGGCGGCTGGGAGGAGGGGAAGGAAAAGTGGTTAGGGTTTGTTGGGGTTTGCACGAATCTCAAATCAATCCAATGGTCAAAAATTT[G/A]
CAAGATATTAGGAGGGTTTTCTACCAAATGATGAGTAGACAGTCCCTTTTTTTTTTCTTTTGCAGAACGTGAACCTGCTGAACTTGTACACACCCATGTA
TACATGGGTGTGTACAAGTTCAGCAGGTTCACGTTCTGCAAAAGAAAAAAAAAAGGGACTGTCTACTCATCATTTGGTAGAAAACCCTCCTAATATCTTG[C/T]
AAATTTTTGACCATTGGATTGATTTGAGATTCGTGCAAACCCCAACAAACCCTAACCACTTTTCCTTCCCCTCCTCCCAGCCGCCGCAAAAATTGCTCGA
| Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 79.80% | 20.20% | 0.02% | 0.00% | NA |
| All Indica | 2759 | 72.10% | 27.80% | 0.04% | 0.00% | NA |
| All Japonica | 1512 | 94.80% | 5.20% | 0.00% | 0.00% | NA |
| Aus | 269 | 63.20% | 36.80% | 0.00% | 0.00% | NA |
| Indica I | 595 | 93.80% | 6.20% | 0.00% | 0.00% | NA |
| Indica II | 465 | 82.80% | 17.20% | 0.00% | 0.00% | NA |
| Indica III | 913 | 52.10% | 47.90% | 0.00% | 0.00% | NA |
| Indica Intermediate | 786 | 72.60% | 27.20% | 0.13% | 0.00% | NA |
| Temperate Japonica | 767 | 98.40% | 1.60% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 89.70% | 10.30% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 94.20% | 5.80% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 99.00% | 1.00% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 92.20% | 7.80% | 0.00% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1125147337 | G -> A | LOC_Os11g41820.1 | downstream_gene_variant ; 1366.0bp to feature; MODIFIER | silent_mutation | Average:76.71; most accessible tissue: Zhenshan97 panicle, score: 87.126 | N | N | N | N |
| vg1125147337 | G -> A | LOC_Os11g41820.2 | downstream_gene_variant ; 1366.0bp to feature; MODIFIER | silent_mutation | Average:76.71; most accessible tissue: Zhenshan97 panicle, score: 87.126 | N | N | N | N |
| vg1125147337 | G -> A | LOC_Os11g41800-LOC_Os11g41820 | intergenic_region ; MODIFIER | silent_mutation | Average:76.71; most accessible tissue: Zhenshan97 panicle, score: 87.126 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1125147337 | 9.09E-07 | NA | mr1133 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1125147337 | 2.73E-06 | 1.47E-09 | mr1133 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1125147337 | 3.16E-06 | NA | mr1133_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1125147337 | 2.13E-06 | 4.39E-11 | mr1133_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1125147337 | NA | 5.06E-09 | mr1667_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1125147337 | NA | 2.94E-08 | mr1842_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |