RiceVarMap2

Search for Variation information by Variation ID:

Detailed information for vg1125127481:

Variant ID: vg1125127481 (JBrowse)	Variation Type: SNP
Chromosome: chr11	Position: 25127481
Reference Allele: C	Alternative Allele: T
Primary Allele: T	Secondary Allele: C

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

TAGTCCGTAGAATATATATGATCCAAAGTAATATTTTTTTAATAATATAGTTAACTTGGTTCTTTAATTTTAAATTTTGTAATAAATAATTTAATTTATC[C/T]
CCTACTTAGGCTACATTTGATCTCATTGGTTGAGCTTATGTAGGGCACGCAAAATGATGTAGGTCATCAATTCAATATTAATTAAGTATTATATTACAAA

Reverse complement sequence

TTTGTAATATAATACTTAATTAATATTGAATTGATGACCTACATCATTTTGCGTGCCCTACATAAGCTCAACCAATGAGATCAAATGTAGCCTAAGTAGG[G/A]
GATAAATTAAATTATTTATTACAAAATTTAAAATTAAAGAACCAAGTTAACTATATTATTAAAAAAATATTACTTTGGATCATATATATTCTACGGACTA

Allele Frequencies:

Search:

Populations	Population Size	Frequency of T(primary allele)	Frequency of C(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	82.80%	16.10%	1.02%	0.00%	NA
All Indica	2759	97.60%	1.10%	1.30%	0.00%	NA
All Japonica	1512	55.40%	44.00%	0.66%	0.00%	NA
Aus	269	98.50%	0.70%	0.74%	0.00%	NA
Indica I	595	95.50%	1.00%	3.53%	0.00%	NA
Indica II	465	98.70%	1.30%	0.00%	0.00%	NA
Indica III	913	99.60%	0.30%	0.11%	0.00%	NA
Indica Intermediate	786	96.20%	2.00%	1.78%	0.00%	NA
Temperate Japonica	767	33.10%	65.70%	1.17%	0.00%	NA
Tropical Japonica	504	83.90%	16.10%	0.00%	0.00%	NA
Japonica Intermediate	241	66.40%	33.20%	0.41%	0.00%	NA
VI/Aromatic	96	51.00%	49.00%	0.00%	0.00%	NA
Intermediate	90	80.00%	20.00%	0.00%	0.00%	NA

Showing 1 to 13 of 13 entries

Allele Effect:

Search:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1125127481	C -> T	LOC_Os11g41800-LOC_Os11g41820	intergenic_region ; MODIFIER	silent_mutation	Average:25.499; most accessible tissue: Callus, score: 53.55	N	N	N	N

Showing 1 to 1 of 1 entries

Putative Genotype-Phenotype Associations:

Show entries

Search:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1125127481	1.75E-14	NA	mr1238	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125127481	1.08E-10	1.81E-10	mr1238	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125127481	4.23E-11	3.36E-29	mr1300	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125127481	NA	2.39E-08	mr1300	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125127481	7.80E-15	NA	mr1309	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125127481	1.02E-13	1.57E-10	mr1309	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125127481	1.92E-09	5.64E-39	mr1310	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125127481	NA	1.70E-08	mr1310	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125127481	1.81E-15	NA	mr1484	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125127481	8.26E-12	2.39E-09	mr1484	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251

Showing 1 to 10 of 40 entries

Previous1 2 3 4Next

Search for Variation information by Variation ID:

Detailed information for vg1125127481:

Flanking Sequence (100 bp) in Reference Genome:

Reverse complement sequence

Allele Frequencies:

Allele Effect:

Putative Genotype-Phenotype Associations:

RiceVarMap v2.0

Tools

Blast

Design Primer by Variation ID

Design Primer by Region

Haplotype Network Analysis

Varitation Coordinate Convert

Contact