RiceVarMap2

Search for Variation information by Variation ID:

Detailed information for vg1125117714:

Variant ID: vg1125117714 (JBrowse)	Variation Type: SNP
Chromosome: chr11	Position: 25117714
Reference Allele: C	Alternative Allele: T
Primary Allele: C	Secondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

CCTCTATTTATTTTAAGGATTTGCAATGATTCATATTTGTCACCGTGGGTACCAGCACTATGTCCTGGGACTGGTACTGTGATCGCGGTTTCGTAGGAAG[C/T]
GGTTCACGCCGTTTTTCCTACGACACGCTCCTGTCAGGTGCCGTTGTACGAGCACAGCCGTCCCTGTCACGGAGGATATTACTAGGAGCCCGAGGGCTGG

Reverse complement sequence

CCAGCCCTCGGGCTCCTAGTAATATCCTCCGTGACAGGGACGGCTGTGCTCGTACAACGGCACCTGACAGGAGCGTGTCGTAGGAAAAACGGCGTGAACC[G/A]
CTTCCTACGAAACCGCGATCACAGTACCAGTCCCAGGACATAGTGCTGGTACCCACGGTGACAAATATGAATCATTGCAAATCCTTAAAATAAATAGAGG

Allele Frequencies:

Search:

Populations	Population Size	Frequency of C(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	94.90%	4.90%	0.08%	0.04%	NA
All Indica	2759	99.70%	0.10%	0.11%	0.07%	NA
All Japonica	1512	85.10%	14.90%	0.00%	0.00%	NA
Aus	269	98.90%	1.10%	0.00%	0.00%	NA
Indica I	595	100.00%	0.00%	0.00%	0.00%	NA
Indica II	465	99.40%	0.00%	0.22%	0.43%	NA
Indica III	913	99.80%	0.10%	0.11%	0.00%	NA
Indica Intermediate	786	99.60%	0.30%	0.13%	0.00%	NA
Temperate Japonica	767	76.80%	23.20%	0.00%	0.00%	NA
Tropical Japonica	504	96.40%	3.60%	0.00%	0.00%	NA
Japonica Intermediate	241	88.00%	12.00%	0.00%	0.00%	NA
VI/Aromatic	96	99.00%	1.00%	0.00%	0.00%	NA
Intermediate	90	97.80%	1.10%	1.11%	0.00%	NA

Showing 1 to 13 of 13 entries

Allele Effect:

Search:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1125117714	C -> T	LOC_Os11g41800.1	downstream_gene_variant ; 4221.0bp to feature; MODIFIER	silent_mutation	Average:41.875; most accessible tissue: Callus, score: 61.467	N	N	N	N
vg1125117714	C -> T	LOC_Os11g41800-LOC_Os11g41820	intergenic_region ; MODIFIER	silent_mutation	Average:41.875; most accessible tissue: Callus, score: 61.467	N	N	N	N
vg1125117714	C -> DEL	N	N	silent_mutation	Average:41.875; most accessible tissue: Callus, score: 61.467	N	N	N	N

Showing 1 to 3 of 3 entries

Putative Genotype-Phenotype Associations:

Show entries

Search:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1125117714	2.78E-20	NA	mr1238	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125117714	3.16E-12	3.02E-08	mr1238	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125117714	6.39E-14	NA	mr1300	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125117714	2.31E-09	NA	mr1300	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125117714	2.23E-17	NA	mr1309	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125117714	4.83E-13	1.54E-08	mr1309	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125117714	1.85E-14	NA	mr1310	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125117714	4.75E-09	NA	mr1310	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125117714	3.20E-17	9.42E-21	mr1484	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125117714	1.07E-11	8.65E-09	mr1484	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251

Showing 1 to 10 of 34 entries

Previous1 2 3 4Next

Search for Variation information by Variation ID:

Detailed information for vg1125117714:

Flanking Sequence (100 bp) in Reference Genome:

Reverse complement sequence

Allele Frequencies:

Allele Effect:

Putative Genotype-Phenotype Associations:

RiceVarMap v2.0

Tools

Blast

Design Primer by Variation ID

Design Primer by Region

Haplotype Network Analysis

Varitation Coordinate Convert

Contact