\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1125117525:

Variant ID: vg1125117525 (JBrowse)Variation Type: SNP
Chromosome: chr11Position: 25117525
Reference Allele: TAlternative Allele: C
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


CCGTCCTGAAGCTAAAGATGAAGTGAATTGAAGAATAGGGTTTCGTCCTGGTTCCCAGCCGTCGCCTGTAGTGTTGGGTGTTAGACCGTTGGTTCCGCTG[T/C]
TGTTGCTGTTGCTGGTGTTTCCTCGTCTGTGTCTTCGTTTGTATTCTCAGGCTGTCCTGAGCTGCAACCTAAGTTAAGGTAAATAAGTCCTCTATTTATT

Reverse complement sequence

AATAAATAGAGGACTTATTTACCTTAACTTAGGTTGCAGCTCAGGACAGCCTGAGAATACAAACGAAGACACAGACGAGGAAACACCAGCAACAGCAACA[A/G]
CAGCGGAACCAACGGTCTAACACCCAACACTACAGGCGACGGCTGGGAACCAGGACGAAACCCTATTCTTCAATTCACTTCATCTTTAGCTTCAGGACGG

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 81.20% 18.80% 0.00% 0.00% NA
All Indica  2759 98.00% 2.00% 0.00% 0.00% NA
All Japonica  1512 49.80% 50.20% 0.00% 0.00% NA
Aus  269 98.90% 1.10% 0.00% 0.00% NA
Indica I  595 98.50% 1.50% 0.00% 0.00% NA
Indica II  465 97.20% 2.80% 0.00% 0.00% NA
Indica III  913 99.50% 0.50% 0.00% 0.00% NA
Indica Intermediate  786 96.40% 3.60% 0.00% 0.00% NA
Temperate Japonica  767 36.00% 64.00% 0.00% 0.00% NA
Tropical Japonica  504 64.70% 35.30% 0.00% 0.00% NA
Japonica Intermediate  241 62.70% 37.30% 0.00% 0.00% NA
VI/Aromatic  96 52.10% 47.90% 0.00% 0.00% NA
Intermediate  90 73.30% 26.70% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1125117525 T -> C LOC_Os11g41800.1 downstream_gene_variant ; 4032.0bp to feature; MODIFIER silent_mutation Average:27.538; most accessible tissue: Zhenshan97 flag leaf, score: 43.728 N N N N
vg1125117525 T -> C LOC_Os11g41800-LOC_Os11g41820 intergenic_region ; MODIFIER silent_mutation Average:27.538; most accessible tissue: Zhenshan97 flag leaf, score: 43.728 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1125117525 1.30E-17 NA mr1238 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125117525 8.71E-13 3.66E-14 mr1238 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125117525 1.38E-07 8.49E-22 mr1300 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125117525 NA 6.10E-06 mr1300 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125117525 1.17E-14 NA mr1309 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125117525 1.60E-15 3.48E-14 mr1309 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125117525 6.61E-08 NA mr1310 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125117525 1.47E-20 NA mr1484 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125117525 7.03E-15 1.53E-15 mr1484 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125117525 1.69E-06 NA mr1498 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125117525 1.89E-06 1.89E-06 mr1609 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125117525 9.47E-15 NA mr1841 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125117525 1.53E-13 4.13E-14 mr1841 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125117525 3.55E-14 NA mr1900 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125117525 1.89E-16 1.92E-18 mr1900 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125117525 1.26E-07 NA mr1926 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125117525 3.31E-06 NA mr1945 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125117525 5.72E-06 5.72E-06 mr1945 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125117525 1.00E-07 3.95E-12 mr1959 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125117525 5.34E-07 5.71E-08 mr1959 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125117525 1.50E-14 NA mr1238_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125117525 2.59E-11 1.21E-11 mr1238_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125117525 1.07E-06 NA mr1310_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125117525 5.37E-14 NA mr1484_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125117525 7.76E-11 7.76E-11 mr1484_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125117525 1.50E-08 NA mr1609_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125117525 2.72E-09 2.72E-09 mr1609_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125117525 1.25E-16 NA mr1841_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125117525 1.22E-12 1.43E-12 mr1841_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125117525 4.20E-12 NA mr1900_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125117525 4.18E-10 4.72E-11 mr1900_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125117525 4.28E-10 NA mr1945_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125117525 1.97E-09 1.97E-09 mr1945_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251