Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1125116622:

Variant ID: vg1125116622 (JBrowse)	Variation Type: SNP
Chromosome: chr11	Position: 25116622
Reference Allele: A	Alternative Allele: G
Primary Allele: G	Secondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

GGGAAACCTCGCATGCCAATAGTTGGGAACGCCGGGGCGGGGTCAGGACAAACCGAGTTCCTGGTAAGGCAAGGACGAGAAGCTTGCTCTCTTACCGATC[A/G]
AGGTGGTTGGAGTTGATTTGTGAATGCCTAAAATGGTCTATATTTATCTGAGGATTTGATCCTTCTATGTGGCATGAGGTAACCCTGGGTCGGCTTGGGA

Reverse complement sequence

TCCCAAGCCGACCCAGGGTTACCTCATGCCACATAGAAGGATCAAATCCTCAGATAAATATAGACCATTTTAGGCATTCACAAATCAACTCCAACCACCT[T/C]
GATCGGTAAGAGAGCAAGCTTCTCGTCCTTGCCTTACCAGGAACTCGGTTTGTCCTGACCCCGCCCCGGCGTTCCCAACTATTGGCATGCGAGGTTTCCC

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	69.50%	30.50%	0.04%	0.00%	NA
All Indica	2759	91.00%	8.90%	0.04%	0.00%	NA
All Japonica	1512	33.90%	66.10%	0.00%	0.00%	NA
Aus	269	65.80%	34.20%	0.00%	0.00%	NA
Indica I	595	97.30%	2.70%	0.00%	0.00%	NA
Indica II	465	86.00%	13.80%	0.22%	0.00%	NA
Indica III	913	92.40%	7.60%	0.00%	0.00%	NA
Indica Intermediate	786	87.70%	12.30%	0.00%	0.00%	NA
Temperate Japonica	767	11.60%	88.40%	0.00%	0.00%	NA
Tropical Japonica	504	60.90%	39.10%	0.00%	0.00%	NA
Japonica Intermediate	241	48.10%	51.90%	0.00%	0.00%	NA
VI/Aromatic	96	29.20%	70.80%	0.00%	0.00%	NA
Intermediate	90	61.10%	37.80%	1.11%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1125116622	A -> G	LOC_Os11g41800.1	downstream_gene_variant ; 3129.0bp to feature; MODIFIER	silent_mutation	Average:27.567; most accessible tissue: Minghui63 young leaf, score: 40.718	N	N	N	N
vg1125116622	A -> G	LOC_Os11g41800-LOC_Os11g41820	intergenic_region ; MODIFIER	silent_mutation	Average:27.567; most accessible tissue: Minghui63 young leaf, score: 40.718	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1125116622	NA	2.15E-08	mr1045	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125116622	NA	6.47E-06	mr1045	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125116622	7.18E-09	6.22E-10	mr1238	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125116622	NA	1.64E-06	mr1309	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125116622	NA	2.15E-08	mr1723	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125116622	NA	4.63E-06	mr1906	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125116622	NA	3.30E-06	mr1063_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125116622	NA	6.07E-07	mr1206_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125116622	1.80E-06	8.70E-07	mr1238_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125116622	NA	5.71E-06	mr1239_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125116622	NA	7.52E-06	mr1263_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125116622	1.93E-07	1.24E-07	mr1484_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125116622	NA	2.14E-11	mr1580_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125116622	NA	2.52E-06	mr1723_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125116622	NA	7.50E-09	mr1746_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125116622	NA	4.59E-06	mr1763_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125116622	NA	1.76E-09	mr1825_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125116622	1.72E-07	4.24E-08	mr1841_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125116622	4.79E-06	1.67E-06	mr1900_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251