RiceVarMap2

Search for Variation information by Variation ID:

Detailed information for vg1125116621:

Variant ID: vg1125116621 (JBrowse)	Variation Type: SNP
Chromosome: chr11	Position: 25116621
Reference Allele: C	Alternative Allele: A
Primary Allele: A	Secondary Allele: C

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

AGGGAAACCTCGCATGCCAATAGTTGGGAACGCCGGGGCGGGGTCAGGACAAACCGAGTTCCTGGTAAGGCAAGGACGAGAAGCTTGCTCTCTTACCGAT[C/A]
AAGGTGGTTGGAGTTGATTTGTGAATGCCTAAAATGGTCTATATTTATCTGAGGATTTGATCCTTCTATGTGGCATGAGGTAACCCTGGGTCGGCTTGGG

Reverse complement sequence

CCCAAGCCGACCCAGGGTTACCTCATGCCACATAGAAGGATCAAATCCTCAGATAAATATAGACCATTTTAGGCATTCACAAATCAACTCCAACCACCTT[G/T]
ATCGGTAAGAGAGCAAGCTTCTCGTCCTTGCCTTACCAGGAACTCGGTTTGTCCTGACCCCGCCCCGGCGTTCCCAACTATTGGCATGCGAGGTTTCCCT

Allele Frequencies:

Search:

Populations	Population Size	Frequency of A(primary allele)	Frequency of C(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	69.50%	26.10%	2.88%	1.50%	NA
All Indica	2759	91.00%	5.20%	2.54%	1.20%	NA
All Japonica	1512	33.90%	66.00%	0.13%	0.00%	NA
Aus	269	66.20%	6.70%	16.73%	10.41%	NA
Indica I	595	97.30%	2.50%	0.17%	0.00%	NA
Indica II	465	86.00%	3.90%	6.67%	3.44%	NA
Indica III	913	92.40%	6.90%	0.66%	0.00%	NA
Indica Intermediate	786	87.70%	6.10%	4.07%	2.16%	NA
Temperate Japonica	767	11.60%	88.10%	0.26%	0.00%	NA
Tropical Japonica	504	60.90%	39.10%	0.00%	0.00%	NA
Japonica Intermediate	241	48.10%	51.90%	0.00%	0.00%	NA
VI/Aromatic	96	29.20%	49.00%	14.58%	7.29%	NA
Intermediate	90	61.10%	30.00%	5.56%	3.33%	NA

Showing 1 to 13 of 13 entries

Allele Effect:

Search:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1125116621	C -> A	LOC_Os11g41800.1	downstream_gene_variant ; 3128.0bp to feature; MODIFIER	silent_mutation	Average:27.567; most accessible tissue: Minghui63 young leaf, score: 40.718	N	N	N	N
vg1125116621	C -> A	LOC_Os11g41800-LOC_Os11g41820	intergenic_region ; MODIFIER	silent_mutation	Average:27.567; most accessible tissue: Minghui63 young leaf, score: 40.718	N	N	N	N
vg1125116621	C -> DEL	N	N	silent_mutation	Average:27.567; most accessible tissue: Minghui63 young leaf, score: 40.718	N	N	N	N

Showing 1 to 3 of 3 entries

Putative Genotype-Phenotype Associations:

Show entries

Search:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1125116621	NA	2.06E-08	mr1045	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125116621	NA	4.98E-06	mr1045	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125116621	NA	2.46E-07	mr1229	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125116621	1.39E-08	1.49E-09	mr1238	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125116621	NA	9.73E-06	mr1272	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125116621	NA	3.19E-06	mr1309	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125116621	NA	8.95E-13	mr1580	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125116621	NA	2.99E-08	mr1723	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125116621	NA	5.09E-07	mr1841	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125116621	NA	1.55E-06	mr1906	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251

Showing 1 to 10 of 17 entries

Previous1 2Next

Search for Variation information by Variation ID:

Detailed information for vg1125116621:

Flanking Sequence (100 bp) in Reference Genome:

Reverse complement sequence

Allele Frequencies:

Allele Effect:

Putative Genotype-Phenotype Associations:

RiceVarMap v2.0

Tools

Blast

Design Primer by Variation ID

Design Primer by Region

Haplotype Network Analysis

Varitation Coordinate Convert

Contact