\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1125115838:

Variant ID: vg1125115838 (JBrowse)Variation Type: SNP
Chromosome: chr11Position: 25115838
Reference Allele: CAlternative Allele: T
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


CATCCCTCCTTCCTTTTCTTTTCCAAAGGATTTGATAAATCCTTTTCCTTTAGACAGAAAATCCAAATAATCTTAGGAAATCCATATCTCCTCAACCGCT[C/T]
GTCCGATTGACTCCATTCCTCTTCCAGTAATTCCGTAAATTGAGATCTATTTAATGGCACTATTATTTAGTCTAAATAGGGTCTTTTTCTTGGTCTTTTG

Reverse complement sequence

CAAAAGACCAAGAAAAAGACCCTATTTAGACTAAATAATAGTGCCATTAAATAGATCTCAATTTACGGAATTACTGGAAGAGGAATGGAGTCAATCGGAC[G/A]
AGCGGTTGAGGAGATATGGATTTCCTAAGATTATTTGGATTTTCTGTCTAAAGGAAAAGGATTTATCAAATCCTTTGGAAAAGAAAAGGAAGGAGGGATG

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 91.00% 5.10% 2.33% 1.57% NA
All Indica  2759 96.70% 0.10% 2.07% 1.09% NA
All Japonica  1512 84.50% 15.30% 0.26% 0.00% NA
Aus  269 73.60% 1.10% 14.87% 10.41% NA
Indica I  595 99.80% 0.00% 0.17% 0.00% NA
Indica II  465 91.80% 0.00% 5.16% 3.01% NA
Indica III  913 99.30% 0.10% 0.44% 0.11% NA
Indica Intermediate  786 94.30% 0.30% 3.56% 1.91% NA
Temperate Japonica  767 76.10% 23.50% 0.39% 0.00% NA
Tropical Japonica  504 96.40% 3.60% 0.00% 0.00% NA
Japonica Intermediate  241 85.90% 13.70% 0.41% 0.00% NA
VI/Aromatic  96 79.20% 1.00% 8.33% 11.46% NA
Intermediate  90 92.20% 1.10% 1.11% 5.56% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1125115838 C -> T LOC_Os11g41800.1 downstream_gene_variant ; 2345.0bp to feature; MODIFIER silent_mutation Average:61.786; most accessible tissue: Minghui63 panicle, score: 82.797 N N N N
vg1125115838 C -> T LOC_Os11g41800-LOC_Os11g41820 intergenic_region ; MODIFIER silent_mutation Average:61.786; most accessible tissue: Minghui63 panicle, score: 82.797 N N N N
vg1125115838 C -> DEL N N silent_mutation Average:61.786; most accessible tissue: Minghui63 panicle, score: 82.797 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1125115838 3.60E-25 2.04E-28 mr1238 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125115838 9.43E-15 1.16E-09 mr1238 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125115838 7.52E-14 NA mr1300 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125115838 1.36E-08 NA mr1300 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125115838 2.25E-21 NA mr1309 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125115838 5.13E-16 1.00E-09 mr1309 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125115838 2.01E-15 NA mr1310 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125115838 5.82E-08 NA mr1310 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125115838 3.22E-20 1.40E-23 mr1484 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125115838 9.85E-14 4.92E-10 mr1484 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125115838 5.66E-07 NA mr1498 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125115838 5.34E-16 NA mr1841 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125115838 1.98E-12 4.28E-09 mr1841 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125115838 1.23E-17 2.65E-17 mr1900 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125115838 1.92E-15 2.70E-08 mr1900 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125115838 1.02E-16 NA mr1926 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125115838 6.77E-09 NA mr1926 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125115838 7.26E-08 2.46E-11 mr1945 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125115838 1.31E-06 1.31E-06 mr1945 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125115838 2.92E-09 NA mr1959 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125115838 1.64E-06 NA mr1959 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125115838 5.18E-23 4.21E-28 mr1238_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125115838 5.85E-16 7.60E-11 mr1238_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125115838 4.42E-14 NA mr1310_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125115838 2.76E-08 NA mr1310_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125115838 3.89E-25 1.51E-30 mr1484_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125115838 5.15E-12 5.16E-12 mr1484_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125115838 9.63E-13 NA mr1609_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125115838 8.82E-08 8.83E-08 mr1609_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125115838 5.80E-25 NA mr1841_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125115838 1.17E-17 1.15E-11 mr1841_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125115838 6.42E-20 3.07E-23 mr1900_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125115838 2.50E-15 1.37E-10 mr1900_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125115838 5.14E-20 9.05E-25 mr1945_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125115838 6.58E-11 6.58E-11 mr1945_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125115838 5.34E-10 NA mr1959_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125115838 4.17E-07 NA mr1959_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251