\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1125113751:

Variant ID: vg1125113751 (JBrowse)Variation Type: SNP
Chromosome: chr11Position: 25113751
Reference Allele: TAlternative Allele: C
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.87, T: 0.12, others allele: 0.00, population size: 103. )

Flanking Sequence (100 bp) in Reference Genome:


CCCGTGCGGTGGTCAGAGTTTTTGGGGGCGCCGCTGTAACGCTCCACTTTTCGTGAGACGTTAAAAACTAATTCGGCAAAATCCTAATTGCGAAAATTTT[T/C]
GTTCTTTGTGTGCGAGTCTAAGTCGTGCCAAGATCTCATTTCAAATCCCGTTGTTCCCTCTCATCGACATCAAATCCTCCTCCTCAAAATTTCTCTTCCA

Reverse complement sequence

TGGAAGAGAAATTTTGAGGAGGAGGATTTGATGTCGATGAGAGGGAACAACGGGATTTGAAATGAGATCTTGGCACGACTTAGACTCGCACACAAAGAAC[A/G]
AAAATTTTCGCAATTAGGATTTTGCCGAATTAGTTTTTAACGTCTCACGAAAAGTGGAGCGTTACAGCGGCGCCCCCAAAAACTCTGACCACCGCACGGG

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 71.90% 26.30% 0.19% 1.59% NA
All Indica  2759 84.10% 13.00% 0.22% 2.65% NA
All Japonica  1512 46.40% 53.50% 0.00% 0.07% NA
Aus  269 97.00% 1.90% 1.12% 0.00% NA
Indica I  595 67.90% 31.10% 0.00% 1.01% NA
Indica II  465 93.80% 5.40% 0.00% 0.86% NA
Indica III  913 84.20% 9.70% 0.22% 5.81% NA
Indica Intermediate  786 90.50% 7.80% 0.51% 1.27% NA
Temperate Japonica  767 36.10% 63.90% 0.00% 0.00% NA
Tropical Japonica  504 55.00% 44.80% 0.00% 0.20% NA
Japonica Intermediate  241 61.40% 38.60% 0.00% 0.00% NA
VI/Aromatic  96 52.10% 47.90% 0.00% 0.00% NA
Intermediate  90 72.20% 26.70% 0.00% 1.11% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1125113751 T -> DEL N N silent_mutation Average:47.932; most accessible tissue: Zhenshan97 panicle, score: 73.605 N N N N
vg1125113751 T -> C LOC_Os11g41800.1 downstream_gene_variant ; 258.0bp to feature; MODIFIER silent_mutation Average:47.932; most accessible tissue: Zhenshan97 panicle, score: 73.605 N N N N
vg1125113751 T -> C LOC_Os11g41800-LOC_Os11g41820 intergenic_region ; MODIFIER silent_mutation Average:47.932; most accessible tissue: Zhenshan97 panicle, score: 73.605 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1125113751 6.44E-14 NA mr1238 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125113751 1.88E-15 8.61E-17 mr1238 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125113751 1.14E-06 NA mr1300 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125113751 NA 4.96E-06 mr1300 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125113751 5.23E-14 NA mr1309 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125113751 4.04E-17 1.19E-15 mr1309 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125113751 4.78E-07 NA mr1310 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125113751 5.88E-13 NA mr1484 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125113751 2.02E-16 6.12E-18 mr1484 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125113751 9.09E-06 NA mr1498 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125113751 1.75E-06 1.75E-06 mr1566 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125113751 1.07E-06 NA mr1609 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125113751 7.30E-08 7.30E-08 mr1609 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125113751 4.64E-12 NA mr1841 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125113751 9.64E-16 1.41E-16 mr1841 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125113751 1.41E-09 NA mr1900 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125113751 6.39E-18 2.39E-19 mr1900 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125113751 1.03E-06 NA mr1926 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125113751 3.46E-06 NA mr1926 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125113751 4.22E-08 4.22E-08 mr1945 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125113751 7.39E-06 NA mr1959 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125113751 7.07E-07 1.69E-07 mr1959 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125113751 8.45E-11 NA mr1238_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125113751 1.98E-13 3.28E-14 mr1238_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125113751 2.56E-10 NA mr1484_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125113751 1.08E-12 1.08E-12 mr1484_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125113751 1.15E-07 NA mr1609_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125113751 5.97E-11 5.97E-11 mr1609_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125113751 3.02E-13 NA mr1841_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125113751 4.46E-15 7.75E-16 mr1841_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125113751 2.71E-09 NA mr1900_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125113751 8.19E-13 3.53E-14 mr1900_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125113751 4.23E-08 NA mr1945_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125113751 5.15E-11 5.15E-11 mr1945_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251