\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1125113390:

Variant ID: vg1125113390 (JBrowse)Variation Type: SNP
Chromosome: chr11Position: 25113390
Reference Allele: TAlternative Allele: C
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.78, T: 0.23, others allele: 0.00, population size: 82. )

Flanking Sequence (100 bp) in Reference Genome:


AGCCTCCGGAGGACAGCCAGCCGCCGTAGGGTCACGGAGCCCCTCCGGAGGCCACATGGTCTCCAGGGCCCCACGGAGTCTCTGGAGGCCATCGATCCGC[T/C]
GGAGGCCAACAAGGACTCCGAGGATATCAAGCCATTAAGGGCCAATCGACTTTCGGCAAACAACGGAACTCCGGAGGCCATCCCGGACTCCGGAGTTGGT

Reverse complement sequence

ACCAACTCCGGAGTCCGGGATGGCCTCCGGAGTTCCGTTGTTTGCCGAAAGTCGATTGGCCCTTAATGGCTTGATATCCTCGGAGTCCTTGTTGGCCTCC[A/G]
GCGGATCGATGGCCTCCAGAGACTCCGTGGGGCCCTGGAGACCATGTGGCCTCCGGAGGGGCTCCGTGACCCTACGGCGGCTGGCTGTCCTCCGGAGGCT

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 56.20% 41.90% 0.40% 1.50% NA
All Indica  2759 61.80% 35.30% 0.33% 2.54% NA
All Japonica  1512 43.00% 56.90% 0.07% 0.07% NA
Aus  269 72.50% 24.90% 2.60% 0.00% NA
Indica I  595 65.40% 33.80% 0.00% 0.84% NA
Indica II  465 74.20% 24.90% 0.22% 0.65% NA
Indica III  913 51.50% 42.50% 0.33% 5.70% NA
Indica Intermediate  786 63.70% 34.40% 0.64% 1.27% NA
Temperate Japonica  767 34.70% 65.30% 0.00% 0.00% NA
Tropical Japonica  504 49.80% 50.00% 0.00% 0.20% NA
Japonica Intermediate  241 55.20% 44.40% 0.41% 0.00% NA
VI/Aromatic  96 50.00% 50.00% 0.00% 0.00% NA
Intermediate  90 62.20% 35.60% 2.22% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1125113390 T -> DEL LOC_Os11g41800.1 N frameshift_variant Average:74.95; most accessible tissue: Zhenshan97 panicle, score: 94.44 N N N N
vg1125113390 T -> C LOC_Os11g41800.1 missense_variant ; p.Leu36Pro; MODERATE nonsynonymous_codon ; L36P Average:74.95; most accessible tissue: Zhenshan97 panicle, score: 94.44 unknown unknown TOLERATED 0.21

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg1125113390 T C 0.03 0.01 0.01 0.01 0.02 0.02

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1125113390 4.11E-14 NA mr1238 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125113390 1.45E-16 1.11E-17 mr1238 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125113390 5.31E-06 2.03E-06 mr1300 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125113390 1.26E-12 NA mr1309 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125113390 4.96E-19 6.48E-18 mr1309 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125113390 5.87E-07 1.73E-07 mr1310 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125113390 2.74E-14 NA mr1484 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125113390 1.08E-19 4.46E-21 mr1484 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125113390 1.43E-06 1.43E-06 mr1498 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125113390 2.42E-06 NA mr1566 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125113390 7.99E-07 7.99E-07 mr1566 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125113390 2.36E-06 NA mr1609 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125113390 1.56E-07 1.56E-07 mr1609 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125113390 3.74E-12 NA mr1841 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125113390 5.22E-18 6.87E-19 mr1841 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125113390 4.98E-11 NA mr1900 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125113390 3.30E-19 5.83E-21 mr1900 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125113390 2.90E-06 NA mr1925 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125113390 2.98E-06 NA mr1926 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125113390 3.59E-06 NA mr1945 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125113390 6.93E-09 6.93E-09 mr1945 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125113390 4.14E-06 NA mr1959 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125113390 4.69E-08 1.28E-08 mr1959 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125113390 3.10E-11 NA mr1238_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125113390 6.88E-15 2.45E-15 mr1238_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125113390 7.66E-12 NA mr1484_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125113390 6.20E-14 6.20E-14 mr1484_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125113390 2.86E-08 NA mr1609_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125113390 1.46E-11 1.46E-11 mr1609_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125113390 2.13E-14 NA mr1841_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125113390 1.01E-16 6.15E-17 mr1841_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125113390 1.53E-09 NA mr1900_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125113390 2.26E-14 1.58E-15 mr1900_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125113390 6.70E-06 6.70E-06 mr1925_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125113390 2.99E-09 NA mr1945_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125113390 3.36E-11 3.36E-11 mr1945_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251