\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1125113372:

Variant ID: vg1125113372 (JBrowse)Variation Type: SNP
Chromosome: chr11Position: 25113372
Reference Allele: TAlternative Allele: C
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


GCTTCCAGAGGCATGATGAGCCTCCGGAGGACAGCCAGCCGCCGTAGGGTCACGGAGCCCCTCCGGAGGCCACATGGTCTCCAGGGCCCCACGGAGTCTC[T/C]
GGAGGCCATCGATCCGCTGGAGGCCAACAAGGACTCCGAGGATATCAAGCCATTAAGGGCCAATCGACTTTCGGCAAACAACGGAACTCCGGAGGCCATC

Reverse complement sequence

GATGGCCTCCGGAGTTCCGTTGTTTGCCGAAAGTCGATTGGCCCTTAATGGCTTGATATCCTCGGAGTCCTTGTTGGCCTCCAGCGGATCGATGGCCTCC[A/G]
GAGACTCCGTGGGGCCCTGGAGACCATGTGGCCTCCGGAGGGGCTCCGTGACCCTACGGCGGCTGGCTGTCCTCCGGAGGCTCATCATGCCTCTGGAAGC

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 79.10% 19.10% 0.23% 1.59% NA
All Indica  2759 95.30% 2.00% 0.07% 2.65% NA
All Japonica  1512 48.50% 51.30% 0.07% 0.07% NA
Aus  269 95.50% 1.50% 2.97% 0.00% NA
Indica I  595 97.50% 1.50% 0.00% 1.01% NA
Indica II  465 96.30% 2.80% 0.00% 0.86% NA
Indica III  913 93.60% 0.40% 0.11% 5.81% NA
Indica Intermediate  786 95.00% 3.60% 0.13% 1.27% NA
Temperate Japonica  767 35.70% 64.30% 0.00% 0.00% NA
Tropical Japonica  504 62.50% 37.10% 0.20% 0.20% NA
Japonica Intermediate  241 60.20% 39.80% 0.00% 0.00% NA
VI/Aromatic  96 52.10% 47.90% 0.00% 0.00% NA
Intermediate  90 73.30% 25.60% 0.00% 1.11% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1125113372 T -> DEL LOC_Os11g41800.1 N frameshift_variant Average:74.459; most accessible tissue: Zhenshan97 panicle, score: 94.278 N N N N
vg1125113372 T -> C LOC_Os11g41800.1 missense_variant ; p.Leu30Pro; MODERATE nonsynonymous_codon ; L30S Average:74.459; most accessible tissue: Zhenshan97 panicle, score: 94.278 unknown unknown TOLERATED 0.34
vg1125113372 T -> C LOC_Os11g41800.1 missense_variant ; p.Leu30Pro; MODERATE nonsynonymous_codon ; L30P Average:74.459; most accessible tissue: Zhenshan97 panicle, score: 94.278 unknown unknown TOLERATED 0.21

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg1125113372 T C 0.06 0.01 0.01 0.01 0.03 0.04

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1125113372 3.28E-16 NA mr1238 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125113372 1.13E-11 8.27E-13 mr1238 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125113372 2.37E-09 1.21E-24 mr1300 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125113372 1.09E-15 NA mr1309 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125113372 1.28E-14 3.06E-13 mr1309 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125113372 1.49E-09 4.10E-35 mr1310 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125113372 1.14E-17 NA mr1484 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125113372 1.95E-13 4.17E-14 mr1484 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125113372 2.78E-07 6.88E-07 mr1498 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125113372 3.85E-06 3.85E-06 mr1609 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125113372 8.02E-15 NA mr1841 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125113372 1.40E-12 3.62E-13 mr1841 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125113372 4.12E-14 NA mr1900 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125113372 2.62E-16 4.67E-18 mr1900 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125113372 1.21E-09 NA mr1926 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125113372 1.43E-10 1.89E-14 mr1959 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125113372 1.06E-07 1.10E-08 mr1959 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125113372 3.57E-14 NA mr1238_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125113372 8.81E-11 4.31E-11 mr1238_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125113372 1.11E-08 NA mr1310_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125113372 4.85E-14 NA mr1484_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125113372 2.32E-10 2.32E-10 mr1484_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125113372 3.31E-08 NA mr1609_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125113372 9.83E-09 9.82E-09 mr1609_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125113372 5.04E-16 NA mr1841_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125113372 8.29E-12 1.15E-11 mr1841_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125113372 6.74E-11 NA mr1900_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125113372 9.66E-10 1.18E-10 mr1900_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125113372 8.30E-06 NA mr1925_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125113372 4.10E-11 NA mr1945_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125113372 5.12E-09 5.12E-09 mr1945_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125113372 7.11E-06 NA mr1959_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251