\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1125110574:

Variant ID: vg1125110574 (JBrowse)Variation Type: SNP
Chromosome: chr11Position: 25110574
Reference Allele: AAlternative Allele: G,T
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.99, others allele: 0.00, population size: 209. )

Flanking Sequence (100 bp) in Reference Genome:


AGTATTTTAGATGACTCTTTGGGTTCTAATAAAACATTTAATTTATCTCTTCATTTAAGTCTTGAATGTACAAAGACTATAAATATGAATAACTTATTTG[A/G,T]
AAAAACTCGAATGTGAAATAGGTGCAACTTTTGTGGATGGAGGGAGTATGTCTTGTAGATGATCGACCTGGCCTGTAAATGCTCAGACAATATTTTTTTT

Reverse complement sequence

AAAAAAAATATTGTCTGAGCATTTACAGGCCAGGTCGATCATCTACAAGACATACTCCCTCCATCCACAAAAGTTGCACCTATTTCACATTCGAGTTTTT[T/C,A]
CAAATAAGTTATTCATATTTATAGTCTTTGTACATTCAAGACTTAAATGAAGAGATAAATTAAATGTTTTATTAGAACCCAAAGAGTCATCTAAAATACT

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 74.50% 23.00% 0.49% 1.80% T: 0.25%
All Indica  2759 94.90% 2.40% 0.22% 2.50% NA
All Japonica  1512 35.50% 62.40% 1.06% 1.06% NA
Aus  269 94.40% 1.90% 0.00% 0.00% T: 3.72%
Indica I  595 97.50% 1.50% 0.00% 1.01% NA
Indica II  465 96.60% 2.60% 0.22% 0.65% NA
Indica III  913 93.30% 0.80% 0.44% 5.48% NA
Indica Intermediate  786 93.80% 4.80% 0.13% 1.27% NA
Temperate Japonica  767 12.90% 83.60% 1.69% 1.83% NA
Tropical Japonica  504 62.10% 37.50% 0.00% 0.40% NA
Japonica Intermediate  241 51.90% 46.90% 1.24% 0.00% NA
VI/Aromatic  96 51.00% 49.00% 0.00% 0.00% NA
Intermediate  90 70.00% 26.70% 1.11% 0.00% T: 2.22%

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1125110574 A -> T LOC_Os11g41780.1 upstream_gene_variant ; 3146.0bp to feature; MODIFIER silent_mutation Average:32.919; most accessible tissue: Callus, score: 50.752 N N N N
vg1125110574 A -> T LOC_Os11g41800.1 upstream_gene_variant ; 2710.0bp to feature; MODIFIER silent_mutation Average:32.919; most accessible tissue: Callus, score: 50.752 N N N N
vg1125110574 A -> T LOC_Os11g41780-LOC_Os11g41800 intergenic_region ; MODIFIER silent_mutation Average:32.919; most accessible tissue: Callus, score: 50.752 N N N N
vg1125110574 A -> DEL N N silent_mutation Average:32.919; most accessible tissue: Callus, score: 50.752 N N N N
vg1125110574 A -> G LOC_Os11g41780.1 upstream_gene_variant ; 3146.0bp to feature; MODIFIER silent_mutation Average:32.919; most accessible tissue: Callus, score: 50.752 N N N N
vg1125110574 A -> G LOC_Os11g41800.1 upstream_gene_variant ; 2710.0bp to feature; MODIFIER silent_mutation Average:32.919; most accessible tissue: Callus, score: 50.752 N N N N
vg1125110574 A -> G LOC_Os11g41780-LOC_Os11g41800 intergenic_region ; MODIFIER silent_mutation Average:32.919; most accessible tissue: Callus, score: 50.752 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1125110574 1.44E-14 NA mr1238 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125110574 NA 1.09E-06 mr1238 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125110574 6.40E-07 1.56E-22 mr1300 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125110574 1.42E-13 NA mr1309 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125110574 1.49E-06 1.69E-06 mr1309 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125110574 1.35E-06 NA mr1310 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125110574 7.70E-17 NA mr1484 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125110574 5.12E-07 2.29E-07 mr1484 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125110574 2.27E-06 NA mr1498 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125110574 2.21E-13 NA mr1841 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125110574 1.89E-06 9.93E-07 mr1841 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125110574 NA 8.14E-06 mr1871 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125110574 1.42E-11 NA mr1900 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125110574 7.23E-07 1.33E-09 mr1900 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125110574 2.45E-06 NA mr1926 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125110574 6.84E-07 2.42E-11 mr1959 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125110574 NA 6.33E-06 mr1063_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125110574 NA 3.67E-06 mr1084_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125110574 NA 5.51E-06 mr1205_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125110574 NA 4.75E-07 mr1206_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125110574 NA 5.79E-07 mr1229_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125110574 2.29E-11 NA mr1238_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125110574 8.96E-11 NA mr1484_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125110574 NA 6.61E-10 mr1580_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125110574 1.07E-06 NA mr1609_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125110574 NA 3.96E-06 mr1723_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125110574 NA 4.04E-09 mr1741_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125110574 NA 1.10E-08 mr1746_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125110574 NA 4.47E-06 mr1763_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125110574 NA 3.74E-06 mr1840_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125110574 5.77E-13 NA mr1841_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125110574 1.74E-08 NA mr1900_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125110574 2.35E-08 NA mr1945_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251