Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1125110574:

Variant ID: vg1125110574 (JBrowse)	Variation Type: SNP
Chromosome: chr11	Position: 25110574
Reference Allele: A	Alternative Allele: G,T
Primary Allele: G	Secondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.99, others allele: 0.00, population size: 209. )

Flanking Sequence (100 bp) in Reference Genome:

AGTATTTTAGATGACTCTTTGGGTTCTAATAAAACATTTAATTTATCTCTTCATTTAAGTCTTGAATGTACAAAGACTATAAATATGAATAACTTATTTG[A/G,T]
AAAAACTCGAATGTGAAATAGGTGCAACTTTTGTGGATGGAGGGAGTATGTCTTGTAGATGATCGACCTGGCCTGTAAATGCTCAGACAATATTTTTTTT

Reverse complement sequence

AAAAAAAATATTGTCTGAGCATTTACAGGCCAGGTCGATCATCTACAAGACATACTCCCTCCATCCACAAAAGTTGCACCTATTTCACATTCGAGTTTTT[T/C,A]
CAAATAAGTTATTCATATTTATAGTCTTTGTACATTCAAGACTTAAATGAAGAGATAAATTAAATGTTTTATTAGAACCCAAAGAGTCATCTAAAATACT

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	74.50%	23.00%	0.49%	1.80%	T: 0.25%
All Indica	2759	94.90%	2.40%	0.22%	2.50%	NA
All Japonica	1512	35.50%	62.40%	1.06%	1.06%	NA
Aus	269	94.40%	1.90%	0.00%	0.00%	T: 3.72%
Indica I	595	97.50%	1.50%	0.00%	1.01%	NA
Indica II	465	96.60%	2.60%	0.22%	0.65%	NA
Indica III	913	93.30%	0.80%	0.44%	5.48%	NA
Indica Intermediate	786	93.80%	4.80%	0.13%	1.27%	NA
Temperate Japonica	767	12.90%	83.60%	1.69%	1.83%	NA
Tropical Japonica	504	62.10%	37.50%	0.00%	0.40%	NA
Japonica Intermediate	241	51.90%	46.90%	1.24%	0.00%	NA
VI/Aromatic	96	51.00%	49.00%	0.00%	0.00%	NA
Intermediate	90	70.00%	26.70%	1.11%	0.00%	T: 2.22%

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1125110574	A -> T	LOC_Os11g41780.1	upstream_gene_variant ; 3146.0bp to feature; MODIFIER	silent_mutation	Average:32.919; most accessible tissue: Callus, score: 50.752	N	N	N	N
vg1125110574	A -> T	LOC_Os11g41800.1	upstream_gene_variant ; 2710.0bp to feature; MODIFIER	silent_mutation	Average:32.919; most accessible tissue: Callus, score: 50.752	N	N	N	N
vg1125110574	A -> T	LOC_Os11g41780-LOC_Os11g41800	intergenic_region ; MODIFIER	silent_mutation	Average:32.919; most accessible tissue: Callus, score: 50.752	N	N	N	N
vg1125110574	A -> DEL	N	N	silent_mutation	Average:32.919; most accessible tissue: Callus, score: 50.752	N	N	N	N
vg1125110574	A -> G	LOC_Os11g41780.1	upstream_gene_variant ; 3146.0bp to feature; MODIFIER	silent_mutation	Average:32.919; most accessible tissue: Callus, score: 50.752	N	N	N	N
vg1125110574	A -> G	LOC_Os11g41800.1	upstream_gene_variant ; 2710.0bp to feature; MODIFIER	silent_mutation	Average:32.919; most accessible tissue: Callus, score: 50.752	N	N	N	N
vg1125110574	A -> G	LOC_Os11g41780-LOC_Os11g41800	intergenic_region ; MODIFIER	silent_mutation	Average:32.919; most accessible tissue: Callus, score: 50.752	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1125110574	1.44E-14	NA	mr1238	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125110574	NA	1.09E-06	mr1238	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125110574	6.40E-07	1.56E-22	mr1300	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125110574	1.42E-13	NA	mr1309	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125110574	1.49E-06	1.69E-06	mr1309	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125110574	1.35E-06	NA	mr1310	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125110574	7.70E-17	NA	mr1484	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125110574	5.12E-07	2.29E-07	mr1484	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125110574	2.27E-06	NA	mr1498	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125110574	2.21E-13	NA	mr1841	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125110574	1.89E-06	9.93E-07	mr1841	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125110574	NA	8.14E-06	mr1871	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125110574	1.42E-11	NA	mr1900	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125110574	7.23E-07	1.33E-09	mr1900	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125110574	2.45E-06	NA	mr1926	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125110574	6.84E-07	2.42E-11	mr1959	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125110574	NA	6.33E-06	mr1063_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125110574	NA	3.67E-06	mr1084_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125110574	NA	5.51E-06	mr1205_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125110574	NA	4.75E-07	mr1206_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125110574	NA	5.79E-07	mr1229_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125110574	2.29E-11	NA	mr1238_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125110574	8.96E-11	NA	mr1484_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125110574	NA	6.61E-10	mr1580_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125110574	1.07E-06	NA	mr1609_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125110574	NA	3.96E-06	mr1723_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125110574	NA	4.04E-09	mr1741_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125110574	NA	1.10E-08	mr1746_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125110574	NA	4.47E-06	mr1763_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125110574	NA	3.74E-06	mr1840_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125110574	5.77E-13	NA	mr1841_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125110574	1.74E-08	NA	mr1900_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125110574	2.35E-08	NA	mr1945_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251