Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923).

Detailed information for vg1125108494:

Variant ID: vg1125108494 (JBrowse)	Variation Type: SNP
Chromosome: chr11	Position: 25108494
Reference Allele: G	Alternative Allele: A
Primary Allele: G	Secondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.99, A: 0.01, others allele: 0.00, population size: 232. )

Flanking Sequence (100 bp) in Reference Genome:

CAGGCGCTGCAGCCACAGATCGACGCGGCAACATCTTCGAGTCCACCATTGGAGCAAACCCTAGCCACAGGAGAGCAGCAATATGAAGGGGATTCGAGGG[G/A]
AGAAACCTACATGGGTGGATTTGAATGATTTGGAGTGGGGAAGAGGAAGAGGCTGGATGGATTTGAAGGATTTGGAGTGGGGAAGAGGAAGAGGCTGGAT

Reverse complement sequence

ATCCAGCCTCTTCCTCTTCCCCACTCCAAATCCTTCAAATCCATCCAGCCTCTTCCTCTTCCCCACTCCAAATCATTCAAATCCACCCATGTAGGTTTCT[C/T]
CCCTCGAATCCCCTTCATATTGCTGCTCTCCTGTGGCTAGGGTTTGCTCCAATGGTGGACTCGAAGATGTTGCCGCGTCGATCTGTGGCTGCAGCGCCTG

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	89.80%	9.00%	1.14%	0.00%	NA
All Indica	2759	86.00%	12.60%	1.38%	0.00%	NA
All Japonica	1512	99.70%	0.20%	0.13%	0.00%	NA
Aus	269	77.70%	18.20%	4.09%	0.00%	NA
Indica I	595	70.80%	27.10%	2.18%	0.00%	NA
Indica II	465	86.20%	13.80%	0.00%	0.00%	NA
Indica III	913	92.70%	5.10%	2.19%	0.00%	NA
Indica Intermediate	786	89.80%	9.50%	0.64%	0.00%	NA
Temperate Japonica	767	99.70%	0.30%	0.00%	0.00%	NA
Tropical Japonica	504	99.60%	0.00%	0.40%	0.00%	NA
Japonica Intermediate	241	99.60%	0.40%	0.00%	0.00%	NA
VI/Aromatic	96	76.00%	22.90%	1.04%	0.00%	NA
Intermediate	90	91.10%	6.70%	2.22%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1125108494	G -> A	LOC_Os11g41780.1	upstream_gene_variant ; 1066.0bp to feature; MODIFIER	silent_mutation	Average:46.654; most accessible tissue: Zhenshan97 flag leaf, score: 59.429	N	N	N	N
vg1125108494	G -> A	LOC_Os11g41800.1	upstream_gene_variant ; 4790.0bp to feature; MODIFIER	silent_mutation	Average:46.654; most accessible tissue: Zhenshan97 flag leaf, score: 59.429	N	N	N	N
vg1125108494	G -> A	LOC_Os11g41780-LOC_Os11g41800	intergenic_region ; MODIFIER	silent_mutation	Average:46.654; most accessible tissue: Zhenshan97 flag leaf, score: 59.429	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1125108494	2.65E-07	NA	mr1238	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125108494	1.22E-07	7.01E-07	mr1238_2	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125108494	2.02E-07	1.27E-07	mr1484_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125108494	5.37E-07	NA	mr1841_2	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125108494	8.69E-07	8.69E-07	mr1945_2	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251