\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1125108494:

Variant ID: vg1125108494 (JBrowse)Variation Type: SNP
Chromosome: chr11Position: 25108494
Reference Allele: GAlternative Allele: A
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.99, A: 0.01, others allele: 0.00, population size: 232. )

Flanking Sequence (100 bp) in Reference Genome:


CAGGCGCTGCAGCCACAGATCGACGCGGCAACATCTTCGAGTCCACCATTGGAGCAAACCCTAGCCACAGGAGAGCAGCAATATGAAGGGGATTCGAGGG[G/A]
AGAAACCTACATGGGTGGATTTGAATGATTTGGAGTGGGGAAGAGGAAGAGGCTGGATGGATTTGAAGGATTTGGAGTGGGGAAGAGGAAGAGGCTGGAT

Reverse complement sequence

ATCCAGCCTCTTCCTCTTCCCCACTCCAAATCCTTCAAATCCATCCAGCCTCTTCCTCTTCCCCACTCCAAATCATTCAAATCCACCCATGTAGGTTTCT[C/T]
CCCTCGAATCCCCTTCATATTGCTGCTCTCCTGTGGCTAGGGTTTGCTCCAATGGTGGACTCGAAGATGTTGCCGCGTCGATCTGTGGCTGCAGCGCCTG

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 89.80% 9.00% 1.14% 0.00% NA
All Indica  2759 86.00% 12.60% 1.38% 0.00% NA
All Japonica  1512 99.70% 0.20% 0.13% 0.00% NA
Aus  269 77.70% 18.20% 4.09% 0.00% NA
Indica I  595 70.80% 27.10% 2.18% 0.00% NA
Indica II  465 86.20% 13.80% 0.00% 0.00% NA
Indica III  913 92.70% 5.10% 2.19% 0.00% NA
Indica Intermediate  786 89.80% 9.50% 0.64% 0.00% NA
Temperate Japonica  767 99.70% 0.30% 0.00% 0.00% NA
Tropical Japonica  504 99.60% 0.00% 0.40% 0.00% NA
Japonica Intermediate  241 99.60% 0.40% 0.00% 0.00% NA
VI/Aromatic  96 76.00% 22.90% 1.04% 0.00% NA
Intermediate  90 91.10% 6.70% 2.22% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1125108494 G -> A LOC_Os11g41780.1 upstream_gene_variant ; 1066.0bp to feature; MODIFIER silent_mutation Average:46.654; most accessible tissue: Zhenshan97 flag leaf, score: 59.429 N N N N
vg1125108494 G -> A LOC_Os11g41800.1 upstream_gene_variant ; 4790.0bp to feature; MODIFIER silent_mutation Average:46.654; most accessible tissue: Zhenshan97 flag leaf, score: 59.429 N N N N
vg1125108494 G -> A LOC_Os11g41780-LOC_Os11g41800 intergenic_region ; MODIFIER silent_mutation Average:46.654; most accessible tissue: Zhenshan97 flag leaf, score: 59.429 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1125108494 2.65E-07 NA mr1238 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125108494 1.22E-07 7.01E-07 mr1238_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125108494 2.02E-07 1.27E-07 mr1484_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125108494 5.37E-07 NA mr1841_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125108494 8.69E-07 8.69E-07 mr1945_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251