\
| Variant ID: vg1125105982 (JBrowse) | Variation Type: SNP |
| Chromosome: chr11 | Position: 25105982 |
| Reference Allele: G | Alternative Allele: A |
| Primary Allele: A | Secondary Allele: G |
Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.73, A: 0.27, others allele: 0.00, population size: 191. )
TGCCAAAAACAGCTTATATGAGTCCAATGGTGTGTTTTACCAAAGTTTTCCGTATCATCCACACACGCGTACATTTCTTCTTTAATTTCTTCTCCTGTCA[G/A]
AATCCTTGGTGGCTCATCAAGCATAAATGTGTTCTTTCTAAATGCATTTAGTTGAGTTCTGAATTCATGTTCGTTGGGTAGAAAGCGTCTATGACAATCA
TGATTGTCATAGACGCTTTCTACCCAACGAACATGAATTCAGAACTCAACTAAATGCATTTAGAAAGAACACATTTATGCTTGATGAGCCACCAAGGATT[C/T]
TGACAGGAGAAGAAATTAAAGAAGAAATGTACGCGTGTGTGGATGATACGGAAAACTTTGGTAAAACACACCATTGGACTCATATAAGCTGTTTTTGGCA
| Populations | Population Size | Frequency of A(primary allele) | Frequency of G(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 70.80% | 29.20% | 0.04% | 0.00% | NA |
| All Indica | 2759 | 93.30% | 6.70% | 0.07% | 0.00% | NA |
| All Japonica | 1512 | 34.00% | 66.00% | 0.00% | 0.00% | NA |
| Aus | 269 | 65.10% | 34.90% | 0.00% | 0.00% | NA |
| Indica I | 595 | 98.20% | 1.70% | 0.17% | 0.00% | NA |
| Indica II | 465 | 85.60% | 14.40% | 0.00% | 0.00% | NA |
| Indica III | 913 | 98.40% | 1.60% | 0.00% | 0.00% | NA |
| Indica Intermediate | 786 | 88.20% | 11.70% | 0.13% | 0.00% | NA |
| Temperate Japonica | 767 | 12.00% | 88.00% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 60.50% | 39.50% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 48.50% | 51.50% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 27.10% | 72.90% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 62.20% | 37.80% | 0.00% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1125105982 | G -> A | LOC_Os11g41780.1 | synonymous_variant ; p.Leu483Leu; LOW | synonymous_codon | Average:24.609; most accessible tissue: Zhenshan97 panicle, score: 36.038 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1125105982 | NA | 1.10E-06 | mr1238 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1125105982 | 3.01E-06 | 1.95E-07 | mr1309 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1125105982 | NA | 1.11E-08 | mr1723 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1125105982 | NA | 5.92E-06 | mr1906 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1125105982 | NA | 6.99E-07 | mr1206_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1125105982 | 3.41E-06 | 3.61E-07 | mr1238_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1125105982 | NA | 8.57E-06 | mr1239_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1125105982 | 5.11E-07 | 8.43E-08 | mr1484_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1125105982 | NA | 8.37E-11 | mr1580_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1125105982 | NA | 1.53E-06 | mr1723_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1125105982 | NA | 8.27E-10 | mr1746_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1125105982 | 2.91E-06 | 7.80E-08 | mr1841_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1125105982 | NA | 7.89E-06 | mr1900_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1125105982 | 9.02E-07 | 9.02E-07 | mr1945_2 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |