Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1125103237:

Variant ID: vg1125103237 (JBrowse)	Variation Type: SNP
Chromosome: chr11	Position: 25103237
Reference Allele: C	Alternative Allele: G
Primary Allele: C	Secondary Allele: G

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 1.00, others allele: 0.00, population size: 250. )

Flanking Sequence (100 bp) in Reference Genome:

TTCTAGAAATGCAGATACTTACTCATCACCCCGAGGTTTCAGCGCGATCTTTCGACCCCGCGGAGGTACTTTTAGTGCAGTTCTTGAGCCCTTCTTCCTC[C/G]
CTCTTTTATTTGGTGGCGCACTGCTCATGCCACTTCCAGCAATATTGGTGGCTTGGGAGGCATTATCAGTATTGCTACTATTACCAGCACAAAGTCTTTG

Reverse complement sequence

CAAAGACTTTGTGCTGGTAATAGTAGCAATACTGATAATGCCTCCCAAGCCACCAATATTGCTGGAAGTGGCATGAGCAGTGCGCCACCAAATAAAAGAG[G/C]
GAGGAAGAAGGGCTCAAGAACTGCACTAAAAGTACCTCCGCGGGGTCGAAAGATCGCGCTGAAACCTCGGGGTGATGAGTAAGTATCTGCATTTCTAGAA

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of G(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	95.50%	0.10%	4.34%	0.02%	NA
All Indica	2759	99.90%	0.00%	0.11%	0.00%	NA
All Japonica	1512	86.50%	0.40%	13.03%	0.07%	NA
Aus	269	98.90%	0.00%	1.12%	0.00%	NA
Indica I	595	100.00%	0.00%	0.00%	0.00%	NA
Indica II	465	100.00%	0.00%	0.00%	0.00%	NA
Indica III	913	99.90%	0.00%	0.11%	0.00%	NA
Indica Intermediate	786	99.70%	0.00%	0.25%	0.00%	NA
Temperate Japonica	767	78.00%	0.70%	21.25%	0.13%	NA
Tropical Japonica	504	98.20%	0.00%	1.79%	0.00%	NA
Japonica Intermediate	241	89.20%	0.40%	10.37%	0.00%	NA
VI/Aromatic	96	99.00%	0.00%	1.04%	0.00%	NA
Intermediate	90	98.90%	0.00%	1.11%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1125103237	C -> DEL	LOC_Os11g41770.1	N	frameshift_variant	Average:16.49; most accessible tissue: Callus, score: 38.406	N	N	N	N
vg1125103237	C -> G	LOC_Os11g41770.1	missense_variant ; p.Gly84Ala; MODERATE	nonsynonymous_codon ; G84A	Average:16.49; most accessible tissue: Callus, score: 38.406	unknown	unknown	DELETERIOUS	0.00

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1125103237	5.52E-07	NA	mr1238	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125103237	4.18E-07	NA	mr1309	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125103237	9.80E-08	2.38E-06	mr1484	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125103237	6.55E-07	5.61E-06	mr1841	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125103237	1.37E-06	NA	mr1900	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125103237	1.15E-07	2.74E-06	mr1238_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125103237	9.36E-07	9.36E-07	mr1484_2	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125103237	1.89E-07	4.81E-06	mr1841_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125103237	1.09E-07	2.39E-06	mr1900_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125103237	4.20E-07	4.21E-07	mr1945_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125103237	7.06E-06	NA	mr1959_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251