\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1125101682:

Variant ID: vg1125101682 (JBrowse)Variation Type: SNP
Chromosome: chr11Position: 25101682
Reference Allele: CAlternative Allele: T
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


AAAGTAGCCAACTGGGTTTAGAAACTAAAAACTAAAACTGAGAGTAAAACTGAGAGTAAAAGTATTATTGTAACTTCATACCAATAACAACTTGTCAGTT[C/T]
GTTCCTGTTTTTTGCGCATGTATTGATTCTCCCGGAGTAGTTGTTCATTTTGTCGAGCCATATTTTGGAAAGCAATTGAATTGGCAGGTCGAACATTTGT

Reverse complement sequence

ACAAATGTTCGACCTGCCAATTCAATTGCTTTCCAAAATATGGCTCGACAAAATGAACAACTACTCCGGGAGAATCAATACATGCGCAAAAAACAGGAAC[G/A]
AACTGACAAGTTGTTATTGGTATGAAGTTACAATAATACTTTTACTCTCAGTTTTACTCTCAGTTTTAGTTTTTAGTTTCTAAACCCAGTTGGCTACTTT

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 97.20% 1.20% 0.83% 0.70% NA
All Indica  2759 99.20% 0.00% 0.22% 0.58% NA
All Japonica  1512 93.90% 3.90% 2.12% 0.07% NA
Aus  269 98.90% 0.00% 0.37% 0.74% NA
Indica I  595 99.80% 0.00% 0.17% 0.00% NA
Indica II  465 97.60% 0.00% 0.43% 1.94% NA
Indica III  913 99.80% 0.00% 0.11% 0.11% NA
Indica Intermediate  786 99.00% 0.00% 0.25% 0.76% NA
Temperate Japonica  767 94.40% 3.10% 2.48% 0.00% NA
Tropical Japonica  504 98.20% 0.80% 0.99% 0.00% NA
Japonica Intermediate  241 83.40% 12.90% 3.32% 0.41% NA
VI/Aromatic  96 89.60% 0.00% 0.00% 10.42% NA
Intermediate  90 95.60% 0.00% 0.00% 4.44% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1125101682 C -> T LOC_Os11g41770.1 missense_variant ; p.Arg437Gln; MODERATE nonsynonymous_codon ; R437Q Average:18.488; most accessible tissue: Zhenshan97 flag leaf, score: 30.355 unknown unknown TOLERATED 0.61
vg1125101682 C -> DEL LOC_Os11g41770.1 N frameshift_variant Average:18.488; most accessible tissue: Zhenshan97 flag leaf, score: 30.355 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1125101682 8.93E-07 1.54E-08 mr1113 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125101682 NA 9.07E-06 mr1114 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125101682 NA 4.19E-07 mr1123 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125101682 NA 9.57E-07 mr1242 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125101682 NA 6.97E-06 mr1496 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125101682 NA 8.31E-06 mr1917 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125101682 NA 5.92E-06 mr1961 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125101682 NA 2.33E-07 mr1113_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125101682 NA 3.00E-06 mr1150_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1125101682 NA 3.61E-06 mr1240_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251