\
| Variant ID: vg1125101682 (JBrowse) | Variation Type: SNP |
| Chromosome: chr11 | Position: 25101682 |
| Reference Allele: C | Alternative Allele: T |
| Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele: Not determined.
AAAGTAGCCAACTGGGTTTAGAAACTAAAAACTAAAACTGAGAGTAAAACTGAGAGTAAAAGTATTATTGTAACTTCATACCAATAACAACTTGTCAGTT[C/T]
GTTCCTGTTTTTTGCGCATGTATTGATTCTCCCGGAGTAGTTGTTCATTTTGTCGAGCCATATTTTGGAAAGCAATTGAATTGGCAGGTCGAACATTTGT
ACAAATGTTCGACCTGCCAATTCAATTGCTTTCCAAAATATGGCTCGACAAAATGAACAACTACTCCGGGAGAATCAATACATGCGCAAAAAACAGGAAC[G/A]
AACTGACAAGTTGTTATTGGTATGAAGTTACAATAATACTTTTACTCTCAGTTTTACTCTCAGTTTTAGTTTTTAGTTTCTAAACCCAGTTGGCTACTTT
| Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 97.20% | 1.20% | 0.83% | 0.70% | NA |
| All Indica | 2759 | 99.20% | 0.00% | 0.22% | 0.58% | NA |
| All Japonica | 1512 | 93.90% | 3.90% | 2.12% | 0.07% | NA |
| Aus | 269 | 98.90% | 0.00% | 0.37% | 0.74% | NA |
| Indica I | 595 | 99.80% | 0.00% | 0.17% | 0.00% | NA |
| Indica II | 465 | 97.60% | 0.00% | 0.43% | 1.94% | NA |
| Indica III | 913 | 99.80% | 0.00% | 0.11% | 0.11% | NA |
| Indica Intermediate | 786 | 99.00% | 0.00% | 0.25% | 0.76% | NA |
| Temperate Japonica | 767 | 94.40% | 3.10% | 2.48% | 0.00% | NA |
| Tropical Japonica | 504 | 98.20% | 0.80% | 0.99% | 0.00% | NA |
| Japonica Intermediate | 241 | 83.40% | 12.90% | 3.32% | 0.41% | NA |
| VI/Aromatic | 96 | 89.60% | 0.00% | 0.00% | 10.42% | NA |
| Intermediate | 90 | 95.60% | 0.00% | 0.00% | 4.44% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1125101682 | C -> T | LOC_Os11g41770.1 | missense_variant ; p.Arg437Gln; MODERATE | nonsynonymous_codon ; R437Q | Average:18.488; most accessible tissue: Zhenshan97 flag leaf, score: 30.355 | unknown | unknown | TOLERATED | 0.61 |
| vg1125101682 | C -> DEL | LOC_Os11g41770.1 | N | frameshift_variant | Average:18.488; most accessible tissue: Zhenshan97 flag leaf, score: 30.355 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1125101682 | 8.93E-07 | 1.54E-08 | mr1113 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1125101682 | NA | 9.07E-06 | mr1114 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1125101682 | NA | 4.19E-07 | mr1123 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1125101682 | NA | 9.57E-07 | mr1242 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1125101682 | NA | 6.97E-06 | mr1496 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1125101682 | NA | 8.31E-06 | mr1917 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1125101682 | NA | 5.92E-06 | mr1961 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1125101682 | NA | 2.33E-07 | mr1113_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1125101682 | NA | 3.00E-06 | mr1150_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1125101682 | NA | 3.61E-06 | mr1240_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |